Human CCL3L1/464.2/ D17S1718 ORF/cDNA clone-Lentivirus particle (NM_021006)

Pre-made Human CCL3L1/464.2/ D17S1718 Lentiviral expression plasmid for CCL3L1 lentivirus packaging, CCL3L1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL3L1/464.2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000966 Human CCL3L1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000966
Gene Name CCL3L1
Accession Number NM_021006
Gene ID 6349
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 282 bp
Gene Alias 464.2, D17S1718, G0S19-2, LD78, LD78-beta(1-70), LD78BETA, MIP1AP, SCYA3L, SCYA3L1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGTCTCCACTGCTGCCCTTGCCGTCCTCCTCTGCACCATGGCTCTCTGCAACCAGGTCCTCTCTGCACCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCCCGACAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGCTCCAAGCCCAGTGTCATCTTCCTAACCAAGAGAGGCCGGCAGGTCTGTGCTGACCCCAGTGAGGAGTGGGTCCAGAAATACGTCAGTGACCTGGAGCTGAGTGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1673-Ab Anti-CL3L1/ CCL3L1/ D17S1718 functional antibody
    Target Antigen GM-Tg-g-SE1673-Ag CCL3L1 protein
    ORF Viral Vector pGMLP000966 Human CCL3L1 Lentivirus plasmid
    ORF Viral Vector vGMLP000966 Human CCL3L1 Lentivirus particle


    Target information

    Target ID GM-SE1673
    Target Name CCL3L1
    Gene ID 6349
    Gene Symbol and Synonyms 464.2,CCL3L1,D17S1718,G0S19-2,LD78,LD78-beta(1-70),LD78BETA,MIP1AP,SCYA3L,SCYA3L1
    Uniprot Accession P16619
    Uniprot Entry Name CL3L1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000277796
    Target Classification Not Available

    This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility. This record represents one of two copies that are present on the ALT_REF_LOCI_2 alternate haplotype of the GRCh38 human reference genome assembly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.