Human SCG5/7B2/ P7B2 ORF/cDNA clone-Lentivirus particle (NM_003020.4)

Pre-made Human SCG5/7B2/ P7B2 Lentiviral expression plasmid for SCG5 lentivirus packaging, SCG5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SCG5/7B2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001208 Human SCG5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001208
Gene Name SCG5
Accession Number NM_003020.4
Gene ID 6447
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 636 bp
Gene Alias 7B2, P7B2, SGNE1, SgV
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCTCCAGGATGGTCTCTACCATGCTATCTGGCCTACTGTTTTGGCTGGCATCTGGATGGACTCCAGCATTTGCTTACAGCCCCCGGACCCCTGACCGGGTCTCAGAAGCAGATATCCAGAGGCTGCTTCATGGTGTTATGGAGCAATTGGGCATTGCCAGGCCCCGAGTGGAATATCCAGCTCACCAGGCCATGAATCTTGTGGGCCCCCAGAGCATTGAAGGTGGAGCTCATGAAGGACTTCAGCATTTGGGTCCTTTTGGCAACATCCCCAACATCGTGGCAGAGTTGACTGGAGACAACATTCCTAAGGACTTTAGTGAGGATCAGGGGTACCCAGACCCTCCAAATCCCTGTCCTGTTGGAAAAACAGATGATGGATGTCTAGAAAACACCCCTGACACTGCAGAGTTCAGTCGAGAGTTCCAGTTGCACCAGCATCTCTTTGATCCGGAACATGACTATCCAGGCTTGGGCAAGTGGAACAAGAAACTCCTTTACGAGAAGATGAAGGGAGGAGAGAGACGAAAGCGGAGGAGTGTCAATCCATATCTACAAGGACAGAGACTGGATAATGTTGTTGCAAAGAAGTCTGTCCCCCATTTTTCAGATGAGGATAAGGATCCAGAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1262-Ab Anti-7B2/ SCG5/ P7B2 functional antibody
    Target Antigen GM-Tg-g-SE1262-Ag SCG5 protein
    ORF Viral Vector pGMLP001208 Human SCG5 Lentivirus plasmid
    ORF Viral Vector vGMLP001208 Human SCG5 Lentivirus particle


    Target information

    Target ID GM-SE1262
    Target Name SCG5
    Gene ID 6447, 20394, 694088, 25719, 478249, 508224, 100071769
    Gene Symbol and Synonyms 7B2,P7B2,SCG5,Sgne-1,SGNE1,SgV
    Uniprot Accession P05408
    Uniprot Entry Name 7B2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166922
    Target Classification Not Available

    This gene encodes a secreted chaperone protein that prevents the aggregation of other secreted proteins, including proteins that are associated with neurodegenerative and metabolic disease. The encoded protein may be best known for its role in the trafficking and activation of prohormone convertase PC2 (encoded by Gene ID: 5126). Phosphorylation of the encoded protein has been shown to have an inhibitory effect on its chaperone function. This gene also produces a ARHGAP11A-SCG5 readthrough transcript and ARHGAP11A-SCG5 protein. [provided by RefSeq, Feb 2019]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.