Human AMBN/AI1F ORF/cDNA clone-Lentivirus particle (NM_016519)

Cat. No.: vGMLP001297

Pre-made Human AMBN/AI1F Lentiviral expression plasmid for AMBN lentivirus packaging, AMBN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AMBN/AI1F products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001297 Human AMBN Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001297
Gene Name AMBN
Accession Number NM_016519
Gene ID 258
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1344 bp
Gene Alias AI1F
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCAGCATCTAAGATTCCACTTTTCAAAATGAAGGACCTGATACTGATCCTATGCCTCCTGGAAATGAGTTTTGCAGTGCCGTTCTTTCCTCAGCAATCTGGAACACCGGGTATGGCTAGTTTGAGCCTTGAGACAATGAGACAGTTGGGAAGTCTGCAGAGATTAAACACACTTTCTCAGTATTCTAGATACGGCTTTGGAAAATCATTTAATTCTTTGTGGATGCACGGTCTCCTCCCACCACATTCCTCTCTTCCATGGATGAGGCCAAGAGAACATGAAACTCAACAGTATGAATATTCTTTGCCTGTGCATCCCCCACCTCTCCCATCACAGCCATCCTTGAAGCCTCAACAGCCAGGACTGAAACCTTTTCTCCAGTCTGCTGCTGCAACCACCAACCAGGCCACAGCACTGAAAGAAGCACTTCAGCCTCCAATTCACCTGGGACATCTGCCCTTGCAGGAAGGAGAACTGCCTCTGGTTCAGCAGCAGGTGGCACCATCAGATAAGCCACCAAAGCCTGAGCTCCCAGGAGTAGATTTTGCTGATCCACAAGGTCCATCACTCCCAGGAATGGATTTTCCTGATCCACAAGGTCCATCACTCCCAGGATTGGATTTTGCTGATCCACAAGGTTCAACAATTTTCCAAATAGCCCGTTTGATTTCTCACGGACCAATGCCACAAAATAAACAATCTCCACTTTATCCAGGAATGTTGTACGTGCCTTTTGGAGCAAATCAATTGAATGCCCCTGCCAGACTTGGCATCATGAGTTCAGAAGAAGTGGCAGGCGGGAGAGAAGACCCAATGGCCTATGGAGCCATGTTTCCAGGATTTGGAGGCATGAGGCCCGGCTTTGAGGGAATGCCCCACAACCCAGCTATGGGCGGTGACTTCACTCTGGAATTTGACTCCCCAGTGGCTGCCACCAAAGGCCCTGAGAACGAAGAAGGAGGTGCACAAGGCTCCCCTATGCCGGAGGCCAACCCAGACAATCTAGAAAACCCAGCTTTCCTTACAGAGCTAGAACCTGCTCCCCACGCAGGGCTCCTTGCTCTCCCTAAGGATGACATTCCCGGCCTGCCAAGGAGCCCTTCAGGGAAGATGAAGGGACTCCCCAGCGTCACCCCAGCAGCTGCTGACCCACTGATGACCCCTGAATTAGCTGATGTTTATAGGACCTACGATGCTGACATGACCACATCCGTGGATTTCCAGGAAGAAGCAACCATGGATACCACGATGGCCCCAAACTCTCTGCAAACATCCATGCCAGGAAACAAAGCCCAGGAGCCCGAGATGATGCATGACGCATGGCATTTCCAAGAGCCCTGA
ORF Protein Sequence MSASKIPLFKMKDLILILCLLEMSFAVPFFPQQSGTPGMASLSLETMRQLGSLQRLNTLSQYSRYGFGKSFNSLWMHGLLPPHSSLPWMRPREHETQQYEYSLPVHPPPLPSQPSLKPQQPGLKPFLQSAAATTNQATALKEALQPPIHLGHLPLQEGELPLVQQQVAPSDKPPKPELPGVDFADPQGPSLPGMDFPDPQGPSLPGLDFADPQGSTIFQIARLISHGPMPQNKQSPLYPGMLYVPFGANQLNAPARLGIMSSEEVAGGREDPMAYGAMFPGFGGMRPGFEGMPHNPAMGGDFTLEFDSPVAATKGPENEEGGAQGSPMPEANPDNLENPAFLTELEPAPHAGLLALPKDDIPGLPRSPSGKMKGLPSVTPAAADPLMTPELADVYRTYDADMTTSVDFQEEATMDTTMAPNSLQTSMPGNKAQEPEMMHDAWHFQEP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0658-Ab Anti-AMBN/ AI1F functional antibody
    Target Antigen GM-Tg-g-SE0658-Ag AMBN protein
    ORF Viral Vector pGMLP001297 Human AMBN Lentivirus plasmid
    ORF Viral Vector vGMLP001297 Human AMBN Lentivirus particle


    Target information

    Target ID GM-SE0658
    Target Name AMBN
    Gene ID 258, 11698, 706845, 25376, 101096807, 482185, 280995, 100054155
    Gene Symbol and Synonyms AI1F,AMBN
    Uniprot Accession Q9NP70
    Uniprot Entry Name AMBN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000178522
    Target Classification Not Available

    This gene encodes the nonamelogenin enamel matrix protein ameloblastin. The encoded protein may be important in enamel matrix formation and mineralization. This gene is located in the calcium-binding phosphoprotein gene cluster on chromosome 4. Mutations in this gene may be associated with dentinogenesis imperfect and autosomal dominant amylogenesis imperfect. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.