Human MMP2/CLG4/ CLG4A ORF/cDNA clone-Lentivirus particle (NM_004530)

Pre-made Human MMP2/CLG4/ CLG4A Lentiviral expression plasmid for MMP2 lentivirus packaging, MMP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MMP-2/MMP2/CLG4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001345 Human MMP2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001345
Gene Name MMP2
Accession Number NM_004530
Gene ID 4313
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1983 bp
Gene Alias CLG4, CLG4A, MMP-2, MMP-II, MONA, TBE-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGCGCTAATGGCCCGGGGCGCGCTCACGGGTCCCCTGAGGGCGCTCTGTCTCCTGGGCTGCCTGCTGAGCCACGCCGCCGCCGCGCCGTCGCCCATCATCAAGTTCCCCGGCGATGTCGCCCCCAAAACGGACAAAGAGTTGGCAGTGCAATACCTGAACACCTTCTATGGCTGCCCCAAGGAGAGCTGCAACCTGTTTGTGCTGAAGGACACACTAAAGAAGATGCAGAAGTTCTTTGGACTGCCCCAGACAGGTGATCTTGACCAGAATACCATCGAGACCATGCGGAAGCCACGCTGCGGCAACCCAGATGTGGCCAACTACAACTTCTTCCCTCGCAAGCCCAAGTGGGACAAGAACCAGATCACATACAGGATCATTGGCTACACACCTGATCTGGACCCAGAGACAGTGGATGATGCCTTTGCTCGTGCCTTCCAAGTCTGGAGCGATGTGACCCCACTGCGGTTTTCTCGAATCCATGATGGAGAGGCAGACATCATGATCAACTTTGGCCGCTGGGAGCATGGCGATGGATACCCCTTTGACGGTAAGGACGGACTCCTGGCTCATGCCTTCGCCCCAGGCACTGGTGTTGGGGGAGACTCCCATTTTGATGACGATGAGCTATGGACCTTGGGAGAAGGCCAAGTGGTCCGTGTGAAGTATGGGAACGCCGATGGGGAGTACTGCAAGTTCCCCTTCTTGTTCAATGGCAAGGAGTACAACAGCTGCACTGATACCGGCCGCAGCGATGGCTTCCTCTGGTGCTCCACCACCTACAACTTTGAGAAGGATGGCAAGTACGGCTTCTGTCCCCATGAAGCCCTGTTCACCATGGGCGGCAACGCTGAAGGACAGCCCTGCAAGTTTCCATTCCGCTTCCAGGGCACATCCTATGACAGCTGCACCACTGAGGGCCGCACGGATGGCTACCGCTGGTGCGGCACCACTGAGGACTACGACCGCGACAAGAAGTATGGCTTCTGCCCTGAGACCGCCATGTCCACTGTTGGTGGGAACTCAGAAGGTGCCCCCTGTGTCTTCCCCTTCACTTTCCTGGGCAACAAATATGAGAGCTGCACCAGCGCCGGCCGCAGTGACGGAAAGATGTGGTGTGCGACCACAGCCAACTACGATGATGACCGCAAGTGGGGCTTCTGCCCTGACCAAGGGTACAGCCTGTTCCTCGTGGCAGCCCACGAGTTTGGCCACGCCATGGGGCTGGAGCACTCCCAAGACCCTGGGGCCCTGATGGCACCCATTTACACCTACACCAAGAACTTCCGTCTGTCCCAGGATGACATCAAGGGCATTCAGGAGCTCTATGGGGCCTCTCCTGACATTGACCTTGGCACCGGCCCCACCCCCACGCTGGGCCCTGTCACTCCTGAGATCTGCAAACAGGACATTGTATTTGATGGCATCGCTCAGATCCGTGGTGAGATCTTCTTCTTCAAGGACCGGTTCATTTGGCGGACTGTGACGCCACGTGACAAGCCCATGGGGCCCCTGCTGGTGGCCACATTCTGGCCTGAGCTCCCGGAAAAGATTGATGCGGTATACGAGGCCCCACAGGAGGAGAAGGCTGTGTTCTTTGCAGGGAATGAATACTGGATCTACTCAGCCAGCACCCTGGAGCGAGGGTACCCCAAGCCACTGACCAGCCTGGGACTGCCCCCTGATGTCCAGCGAGTGGATGCCGCCTTTAACTGGAGCAAAAACAAGAAGACATACATCTTTGCTGGAGACAAATTCTGGAGATACAATGAGGTGAAGAAGAAAATGGATCCTGGCTTCCCCAAGCTCATCGCAGATGCCTGGAATGCCATCCCCGATAACCTGGATGCCGTCGTGGACCTGCAGGGCGGCGGTCACAGCTACTTCTTCAAGGGTGCCTATTACCTGAAGCTGGAGAACCAAAGTCTGAAGAGCGTGAAGTTTGGAAGCATCAAATCCGACTGGCTAGGCTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68251-Ab Anti-MMP2/ MMP-2/ CLG4 monoclonal antibody
    Target Antigen GM-Tg-g-T68251-Ag MMP-2/MMP2 VLP (virus-like particle)
    ORF Viral Vector pGMLV002060 Human MMP2 Lentivirus plasmid
    ORF Viral Vector pGMPC001127 Human MMP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP001345 Human MMP2 Lentivirus plasmid
    ORF Viral Vector pGMAP000238 Human MMP2 Adenovirus plasmid
    ORF Viral Vector vGMLV002060 Human MMP2 Lentivirus particle
    ORF Viral Vector vGMLP001345 Human MMP2 Lentivirus particle
    ORF Viral Vector vGMAP000238 Human MMP2 Adenovirus particle


    Target information

    Target ID GM-T68251
    Target Name MMP-2
    Gene ID 4313, 17390, 698478, 81686, 101098838, 403733, 282872, 100033948
    Gene Symbol and Synonyms CLG4,CLG4A,GelA,MMP-2,MMP-II,MMP2,MONA,TBE-1
    Uniprot Accession P08253
    Uniprot Entry Name MMP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Ovary Cancer, Neoplasm, Type 1 diabetes mellitus, Vesicoureteral reflux, Alport syndrome, Chronic Kidney Disease, Chronic tubulo-interstitial nephritis, Malignant neoplasm of bladder, Malignant neoplasms of female genital organs
    Gene Ensembl ENSG00000087245
    Target Classification Checkpoint-Immuno Oncology

    This gene is a member of the matrix metalloproteinase (MMP) gene family, that are zinc-dependent enzymes capable of cleaving components of the extracellular matrix and molecules involved in signal transduction. The protein encoded by this gene is a gelatinase A, type IV collagenase, that contains three fibronectin type II repeats in its catalytic site that allow binding of denatured type IV and V collagen and elastin. Unlike most MMP family members, activation of this protein can occur on the cell membrane. This enzyme can be activated extracellularly by proteases, or, intracellulary by its S-glutathiolation with no requirement for proteolytical removal of the pro-domain. This protein is thought to be involved in multiple pathways including roles in the nervous system, endometrial menstrual breakdown, regulation of vascularization, and metastasis. Mutations in this gene have been associated with Winchester syndrome and Nodulosis-Arthropathy-Osteolysis (NAO) syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.