Human VASH1/KIAA1036 ORF/cDNA clone-Lentivirus particle (NM_014909)

Pre-made Human VASH1/KIAA1036 Lentiviral expression plasmid for VASH1 lentivirus packaging, VASH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to VASH1/KIAA1036 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001438 Human VASH1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001438
Gene Name VASH1
Accession Number NM_014909
Gene ID 22846
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1098 bp
Gene Alias KIAA1036
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCAGGGGGGAAGAAGGTGGCTGGGGGTGGCAGCAGCGGTGCCACTCCAACGTCCGCTGCGGCCACCGCCCCCTCTGGGGTCAGGCGTTTGGAGACCAGCGAAGGAACCTCAGCCCAGAGAGATGAGGAGCCAGAAGAGGAAGGGGAAGAGGACCTGCGAGACGGAGGCGTCCCCTTCTTTGTCAACCGGGGTGGGCTACCTGTGGATGAGGCCACCTGGGAAAGGATGTGGAAACACGTGGCCAAGATCCACCCCGATGGAGAGAAGGTGGCGCAACGGATCCGTGGGGCCACAGACCTGCCCAAGATCCCCATACCGAGTGTGCCTACGTTCCAGCCGTCTACACCTGTCCCTGAGCGCCTGGAAGCTGTGCAGCGCTACATCAGAGAGCTGCAGTACAATCACACAGGGACACAGTTCTTTGAAATTAAGAAGAGCAGACCTCTGACAGGGCTGATGGACCTGGCCAAGGAAATGACCAAAGAGGCCCTGCCAATCAAATGCCTGGAAGCCGTGATCCTGGGAATTTACCTCACCAACAGCATGCCCACCCTGGAGCGCTTCCCCATCAGCTTCAAGACCTACTTCTCAGGGAACTACTTCCGCCACATCGTGCTGGGGGTGAACTTCGCGGGCCGCTACGGTGCGCTGGGCATGAGTCGGCGCGAGGACCTGATGTACAAGCCGCCCGCCTTCCGCACGCTCAGCGAGCTCGTGCTGGACTTCGAGGCCGCCTACGGCCGCTGCTGGCACGTGCTCAAGAAGGTGAAGCTGGGCCAGAGCGTGTCACACGACCCGCACAGCGTGGAGCAGATCGAGTGGAAGCACTCGGTGCTGGACGTGGAGCGCCTGGGCCGCGATGACTTCCGCAAGGAGCTGGAGCGCCACGCCCGCGACATGCGGCTCAAGATTGGCAAAGGGACGGGCCCTCCCTCTCCCACCAAGGACCGGAAGAAGGATGTTTCTTCCCCGCAGCGGGCCCAGTCCAGCCCCCACCGCAGGAACAGCCGCAGTGAAAGACGGCCCTCGGGTGACAAGAAGACTTCCGAGCCCAAAGCCATGCCAGACCTTAACGGGTACCAGATCCGGGTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1359-Ab Anti-VASH1/ KIAA1036/ TTCP 1 functional antibody
    Target Antigen GM-Tg-g-SE1359-Ag VASH1 protein
    ORF Viral Vector pGMLV001962 Human VASH1 Lentivirus plasmid
    ORF Viral Vector pGMLP001438 Human VASH1 Lentivirus plasmid
    ORF Viral Vector vGMLV001962 Human VASH1 Lentivirus particle
    ORF Viral Vector vGMLP001438 Human VASH1 Lentivirus particle


    Target information

    Target ID GM-SE1359
    Target Name VASH1
    Gene ID 22846, 238328, 703906, 503052, 101100138, 490799, 615419, 100051887
    Gene Symbol and Synonyms D930046M13Rik,G630009D10Rik,KIAA1036,RGD1564082,TTCP 1,VASH1
    Uniprot Accession Q7L8A9
    Uniprot Entry Name VASH1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000071246
    Target Classification Not Available

    Enables actin binding activity and metallocarboxypeptidase activity. Involved in negative regulation of angiogenesis; negative regulation of blood vessel endothelial cell migration; and proteolysis. Acts upstream of or within several processes, including negative regulation of endothelial cell migration; negative regulation of endothelial cell proliferation; and negative regulation of lymphangiogenesis. Located in apical part of cell; endoplasmic reticulum; and extracellular space. Implicated in liver cirrhosis and portal hypertension. Biomarker of liver cirrhosis. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.