Human AVPR2/ADHR/ DI1 ORF/cDNA clone-Lentivirus particle (NM_000054)
Pre-made Human AVPR2/ADHR/ DI1 Lentiviral expression plasmid for AVPR2 lentivirus packaging, AVPR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to V2R/AVPR2/ADHR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001455 | Human AVPR2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001455 |
Gene Name | AVPR2 |
Accession Number | NM_000054 |
Gene ID | 554 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1116 bp |
Gene Alias | ADHR, DI1, DIR, DIR3, NDI, V2R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTCATGGCGTCCACCACTTCCGCTGTGCCTGGGCATCCCTCTCTGCCCAGCCTGCCCAGCAACAGCAGCCAGGAGAGGCCACTGGACACCCGGGACCCGCTGCTAGCCCGGGCGGAGCTGGCGCTGCTCTCCATAGTCTTTGTGGCTGTGGCCCTGAGCAATGGCCTGGTGCTGGCGGCCCTAGCTCGGCGGGGCCGGCGGGGCCACTGGGCACCCATACACGTCTTCATTGGCCACTTGTGCCTGGCCGACCTGGCCGTGGCTCTGTTCCAAGTGCTGCCCCAGCTGGCCTGGAAGGCCACCGACCGCTTCCGTGGGCCAGATGCCCTGTGTCGGGCCGTGAAGTATCTGCAGATGGTGGGCATGTATGCCTCCTCCTACATGATCCTGGCCATGACGCTGGACCGCCACCGTGCCATCTGCCGTCCCATGCTGGCGTACCGCCATGGAAGTGGGGCTCACTGGAACCGGCCGGTGCTAGTGGCTTGGGCCTTCTCGCTCCTTCTCAGCCTGCCCCAGCTCTTCATCTTCGCCCAGCGCAACGTGGAAGGTGGCAGCGGGGTCACTGACTGCTGGGCCTGCTTTGCGGAGCCCTGGGGCCGTCGCACCTATGTCACCTGGATTGCCCTGATGGTGTTCGTGGCACCTACCCTGGGTATCGCCGCCTGCCAGGTGCTCATCTTCCGGGAGATTCATGCCAGTCTGGTGCCAGGGCCATCAGAGAGGCCTGGGGGGCGCCGCAGGGGACGCCGGACAGGCAGCCCCGGTGAGGGAGCCCACGTGTCAGCAGCTGTGGCCAAGACTGTGAGGATGACGCTAGTGATTGTGGTCGTCTATGTGCTGTGCTGGGCACCCTTCTTCCTGGTGCAGCTGTGGGCCGCGTGGGACCCGGAGGCACCTCTGGAAGGGGCGCCCTTTGTGCTACTCATGTTGCTGGCCAGCCTCAACAGCTGCACCAACCCCTGGATCTATGCATCTTTCAGCAGCAGCGTGTCCTCAGAGCTGCGAAGCTTGCTCTGCTGTGCCCGGGGACGCACCCCACCCAGCCTGGGTCCCCAAGATGAGTCCTGCACCACCGCCAGCTCCTCCCTGGCCAAGGACACTTCATCGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T66237-Ab | Anti-V2R/ AVPR2/ ADHR monoclonal antibody |
Target Antigen | GM-Tg-g-T66237-Ag | V2R/AVPR2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001455 | Human AVPR2 Lentivirus plasmid |
ORF Viral Vector | vGMLP001455 | Human AVPR2 Lentivirus particle |
Target information
Target ID | GM-T66237 |
Target Name | V2R |
Gene ID | 554, 12000, 697763, 25108, 101082135, 403804, 281642, 100059066 |
Gene Symbol and Synonyms | ADHR,AVPR2,DI1,DIR,DIR3,ND1,NDI,NDI1,V2R,VPV2R |
Uniprot Accession | P30518 |
Uniprot Entry Name | V2R_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000126895 |
Target Classification | GPCR |
This gene encodes the vasopressin receptor, type 2, also known as the V2 receptor, which belongs to the seven-transmembrane-domain G protein-coupled receptor (GPCR) superfamily, and couples to Gs thus stimulating adenylate cyclase. The subfamily that includes the V2 receptor, the V1a and V1b vasopressin receptors, the oxytocin receptor, and isotocin and mesotocin receptors in non-mammals, is well conserved, though several members signal via other G proteins. All bind similar cyclic nonapeptide hormones. The V2 receptor is expressed in the kidney tubule, predominantly in the distal convoluted tubule and collecting ducts, where its primary property is to respond to the pituitary hormone arginine vasopressin (AVP) by stimulating mechanisms that concentrate the urine and maintain water homeostasis in the organism. When the function of this gene is lost, the disease Nephrogenic Diabetes Insipidus (NDI) results. The V2 receptor is also expressed outside the kidney although its tissue localization is uncertain. When these 'extrarenal receptors' are stimulated by infusion of a V2 selective agonist (dDAVP), a variety of clotting factors are released into the bloodstream. The physiologic importance of this property is not known - its absence does not appear to be detrimental in NDI patients. The gene expression has also been described in fetal lung tissue and lung cancer associated with alternative splicing. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.