Human GALR3 ORF/cDNA clone-Lentivirus particle (NM_003614)

Cat. No.: vGMLP001647

Pre-made Human GALR3/ Lentiviral expression plasmid for GALR3 lentivirus packaging, GALR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to GALR3/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001647 Human GALR3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001647
Gene Name GALR3
Accession Number NM_003614
Gene ID 8484
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1107 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGATGCCCAGAACATTTCACTGGACAGCCCAGGGAGTGTGGGGGCCGTGGCAGTGCCTGTGGTCTTTGCCCTAATCTTCCTGCTGGGCACAGTGGGCAATGGGCTGGTGCTGGCAGTGCTCCTGCAGCCTGGCCCGAGTGCCTGGCAGGAGCCTGGCAGCACCACGGACCTGTTCATCCTCAACCTGGCGGTGGCTGACCTCTGCTTCATCCTGTGCTGCGTGCCCTTCCAGGCCACCATCTACACGCTGGATGCCTGGCTCTTTGGGGCCCTCGTCTGCAAGGCCGTGCACCTGCTCATCTACCTCACCATGTACGCCAGCAGCTTTACGCTGGCTGCTGTCTCCGTGGACAGGTACCTGGCCGTGCGGCACCCGCTGCGCTCGCGCGCCCTGCGCACGCCGCGTAACGCCCGCGCCGCAGTGGGGCTGGTGTGGCTGCTGGCGGCGCTCTTCTCGGCGCCCTACCTCAGCTACTACGGCACCGTGCGCTACGGCGCGCTGGAGCTCTGCGTGCCCGCCTGGGAGGACGCGCGCCGCCGCGCCCTGGACGTGGCCACCTTCGCTGCCGGCTACCTGCTGCCCGTGGCTGTGGTGAGCCTGGCCTACGGGCGCACGCTGCGCTTCCTGTGGGCCGCCGTGGGTCCCGCGGGCGCGGCGGCGGCCGAGGCGCGGCGGAGGGCGACGGGCCGCGCGGGGCGCGCCATGCTGGCGGTGGCCGCGCTCTACGCGCTCTGCTGGGGTCCGCACCACGCGCTCATCCTGTGCTTCTGGTACGGCCGCTTCGCCTTCAGCCCGGCCACCTACGCCTGCCGCCTGGCCTCACACTGCCTGGCCTACGCCAACTCCTGCCTCAACCCGCTCGTCTACGCGCTCGCCTCGCGCCACTTCCGCGCGCGCTTCCGCCGCCTGTGGCCGTGCGGCCGCCGACGCCGCCACCGTGCCCGCCGCGCCTTGCGTCGCGTCCGCCCCGCGTCCTCGGGCCCACCCGGCTGCCCCGGAGACGCCCGGCCTAGCGGGAGGCTGCTGGCTGGTGGCGGCCAGGGCCCGGAGCCCAGGGAGGGACCCGTCCACGGCGGAGAGGCTGCCCGAGGACCGGAATAA
ORF Protein Sequence MADAQNISLDSPGSVGAVAVPVVFALIFLLGTVGNGLVLAVLLQPGPSAWQEPGSTTDLFILNLAVADLCFILCCVPFQATIYTLDAWLFGALVCKAVHLLIYLTMYASSFTLAAVSVDRYLAVRHPLRSRALRTPRNARAAVGLVWLLAALFSAPYLSYYGTVRYGALELCVPAWEDARRRALDVATFAAGYLLPVAVVSLAYGRTLRFLWAAVGPAGAAAAEARRRATGRAGRAMLAVAALYALCWGPHHALILCFWYGRFAFSPATYACRLASHCLAYANSCLNPLVYALASRHFRARFRRLWPCGRRRRHRARRALRRVRPASSGPPGCPGDARPSGRLLAGGGQGPEPREGPVHGGEAARGPE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA139-Ab Anti-GALR3 monoclonal antibody
    Target Antigen GM-Tg-g-TA139-Ag GALR3 VLP (virus-like particle)
    ORF Viral Vector pGMLP001647 Human GALR3 Lentivirus plasmid
    ORF Viral Vector vGMLP001647 Human GALR3 Lentivirus particle


    Target information

    Target ID GM-TA139
    Target Name GALR3
    Gene ID 8484, 14429, 701727, 29235, 109501798, 610233, 788463
    Gene Symbol and Synonyms Galnr3,GALR3
    Uniprot Accession O60755
    Uniprot Entry Name GALR3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000128310
    Target Classification Not Available

    The neuropeptide galanin modulates a variety of physiologic processes including cognition/memory, sensory/pain processing, hormone secretion, and feeding behavior.  The human galanin receptors are G protein-coupled receptors that functionally couple to their intracellular effector through distinct signaling pathways.  GALR3 is found in many tissues and may be expressed as 1.4-, 2.4-, and 5-kb transcripts



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.