Human GALR3 ORF/cDNA clone-Lentivirus particle (NM_003614)
Cat. No.: vGMLP001647
Pre-made Human GALR3/ Lentiviral expression plasmid for GALR3 lentivirus packaging, GALR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
GALR3/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001647 | Human GALR3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001647 |
Gene Name | GALR3 |
Accession Number | NM_003614 |
Gene ID | 8484 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1107 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTGATGCCCAGAACATTTCACTGGACAGCCCAGGGAGTGTGGGGGCCGTGGCAGTGCCTGTGGTCTTTGCCCTAATCTTCCTGCTGGGCACAGTGGGCAATGGGCTGGTGCTGGCAGTGCTCCTGCAGCCTGGCCCGAGTGCCTGGCAGGAGCCTGGCAGCACCACGGACCTGTTCATCCTCAACCTGGCGGTGGCTGACCTCTGCTTCATCCTGTGCTGCGTGCCCTTCCAGGCCACCATCTACACGCTGGATGCCTGGCTCTTTGGGGCCCTCGTCTGCAAGGCCGTGCACCTGCTCATCTACCTCACCATGTACGCCAGCAGCTTTACGCTGGCTGCTGTCTCCGTGGACAGGTACCTGGCCGTGCGGCACCCGCTGCGCTCGCGCGCCCTGCGCACGCCGCGTAACGCCCGCGCCGCAGTGGGGCTGGTGTGGCTGCTGGCGGCGCTCTTCTCGGCGCCCTACCTCAGCTACTACGGCACCGTGCGCTACGGCGCGCTGGAGCTCTGCGTGCCCGCCTGGGAGGACGCGCGCCGCCGCGCCCTGGACGTGGCCACCTTCGCTGCCGGCTACCTGCTGCCCGTGGCTGTGGTGAGCCTGGCCTACGGGCGCACGCTGCGCTTCCTGTGGGCCGCCGTGGGTCCCGCGGGCGCGGCGGCGGCCGAGGCGCGGCGGAGGGCGACGGGCCGCGCGGGGCGCGCCATGCTGGCGGTGGCCGCGCTCTACGCGCTCTGCTGGGGTCCGCACCACGCGCTCATCCTGTGCTTCTGGTACGGCCGCTTCGCCTTCAGCCCGGCCACCTACGCCTGCCGCCTGGCCTCACACTGCCTGGCCTACGCCAACTCCTGCCTCAACCCGCTCGTCTACGCGCTCGCCTCGCGCCACTTCCGCGCGCGCTTCCGCCGCCTGTGGCCGTGCGGCCGCCGACGCCGCCACCGTGCCCGCCGCGCCTTGCGTCGCGTCCGCCCCGCGTCCTCGGGCCCACCCGGCTGCCCCGGAGACGCCCGGCCTAGCGGGAGGCTGCTGGCTGGTGGCGGCCAGGGCCCGGAGCCCAGGGAGGGACCCGTCCACGGCGGAGAGGCTGCCCGAGGACCGGAATAA |
ORF Protein Sequence | MADAQNISLDSPGSVGAVAVPVVFALIFLLGTVGNGLVLAVLLQPGPSAWQEPGSTTDLFILNLAVADLCFILCCVPFQATIYTLDAWLFGALVCKAVHLLIYLTMYASSFTLAAVSVDRYLAVRHPLRSRALRTPRNARAAVGLVWLLAALFSAPYLSYYGTVRYGALELCVPAWEDARRRALDVATFAAGYLLPVAVVSLAYGRTLRFLWAAVGPAGAAAAEARRRATGRAGRAMLAVAALYALCWGPHHALILCFWYGRFAFSPATYACRLASHCLAYANSCLNPLVYALASRHFRARFRRLWPCGRRRRHRARRALRRVRPASSGPPGCPGDARPSGRLLAGGGQGPEPREGPVHGGEAARGPE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-TA139-Ab | Anti-GALR3 monoclonal antibody |
Target Antigen | GM-Tg-g-TA139-Ag | GALR3 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001647 | Human GALR3 Lentivirus plasmid |
ORF Viral Vector | vGMLP001647 | Human GALR3 Lentivirus particle |
Target information
Target ID | GM-TA139 |
Target Name | GALR3 |
Gene ID | 8484, 14429, 701727, 29235, 109501798, 610233, 788463 |
Gene Symbol and Synonyms | Galnr3,GALR3 |
Uniprot Accession | O60755 |
Uniprot Entry Name | GALR3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000128310 |
Target Classification | Not Available |
The neuropeptide galanin modulates a variety of physiologic processes including cognition/memory, sensory/pain processing, hormone secretion, and feeding behavior. The human galanin receptors are G protein-coupled receptors that functionally couple to their intracellular effector through distinct signaling pathways. GALR3 is found in many tissues and may be expressed as 1.4-, 2.4-, and 5-kb transcripts
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.