Human GDF1/DORV/ DTGA3 ORF/cDNA clone-Lentivirus particle (NM_001492)

Pre-made Human GDF1/DORV/ DTGA3 Lentiviral expression plasmid for GDF1 lentivirus packaging, GDF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to GDF1/DORV products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001652 Human GDF1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001652
Gene Name GDF1
Accession Number NM_001492
Gene ID 2657
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1119 bp
Gene Alias DORV, DTGA3, RAI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCACCGCCGCAGCAAGGTCCCTGCGGCCACCACCTCCTCCTCCTCCTGGCCCTGCTGCTGCCCTCGCTGCCCCTGACCCGCGCCCCCGTGCCCCCAGGCCCAGCCGCCGCCCTGCTCCAGGCTCTAGGACTGCGCGATGAGCCCCAGGGTGCCCCCAGGCTCCGGCCGGTTCCCCCGGTCATGTGGCGCCTGTTTCGACGCCGGGACCCCCAGGAGACCAGGTCTGGCTCGCGGCGGACGTCCCCAGGGGTCACCCTGCAACCGTGCCACGTGGAGGAGCTGGGGGTCGCCGGAAACATCGTGCGCCACATCCCGGACCGCGGTGCGCCCACCCGGGCCTCGGAGCCTGCCTCGGCCGCGGGGCATTGCCCTGAGTGGACAGTCGTCTTCGACCTGTCGGCTGTGGAACCCGCTGAGCGCCCGAGCCGGGCCCGCCTGGAGCTGCGTTTCGCGGCGGCGGCGGCGGCAGCCCCGGAGGGCGGCTGGGAGCTGAGCGTGGCGCAAGCGGGCCAGGGCGCGGGCGCGGACCCCGGGCCGGTGCTGCTCCGCCAGTTGGTGCCCGCCCTGGGGCCGCCAGTGCGCGCGGAGCTGCTGGGCGCCGCTTGGGCTCGCAACGCCTCATGGCCGCGCAGCCTCCGCCTGGCGCTGGCGCTACGCCCCCGGGCCCCTGCCGCCTGCGCGCGCCTGGCCGAGGCCTCGCTGCTGCTGGTGACCCTCGACCCGCGCCTGTGCCACCCCCTGGCCCGGCCGCGGCGCGACGCCGAACCCGTGTTGGGCGGCGGCCCCGGGGGCGCTTGTCGCGCGCGGCGGCTGTACGTGAGCTTCCGCGAGGTGGGCTGGCACCGCTGGGTCATCGCGCCGCGCGGCTTCCTGGCCAACTACTGCCAGGGTCAGTGCGCGCTGCCCGTCGCGCTGTCGGGGTCCGGGGGGCCGCCGGCGCTCAACCACGCTGTGCTGCGCGCGCTCATGCACGCGGCCGCCCCGGGAGCCGCCGACCTGCCCTGCTGCGTGCCCGCGCGCCTGTCGCCCATCTCCGTGCTCTTCTTTGACAACAGCGACAACGTGGTGCTGCGGCAGTATGAGGACATGGTGGTGGACGAGTGCGGCTGCCGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0938-Ab Anti-GDF1/ CERS1/ CHTD6 functional antibody
    Target Antigen GM-Tg-g-SE0938-Ag GDF1 protein
    Cytokine cks-Tg-g-GM-SE0938 growth differentiation factor 1 (GDF1) protein & antibody
    ORF Viral Vector pGMLP001652 Human GDF1 Lentivirus plasmid
    ORF Viral Vector vGMLP001652 Human GDF1 Lentivirus particle


    Target information

    Target ID GM-SE0938
    Target Name GDF1
    Gene ID 2657, 14559, 720298, 306351, 101096297, 100686938, 104968455, 111769683
    Gene Symbol and Synonyms CERS1,CHTD6,DORV,DTGA3,Gdf-1,GDF1,LAG1,LASS1,RAI,UOG1
    Uniprot Accession P27539
    Uniprot Entry Name GDF1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000130283
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. Studies in rodents suggest that this protein is involved in the establishment of left-right asymmetry in early embryogenesis and in neural development in later embryogenesis. The encoded protein is translated from a bicistronic mRNA that also encodes ceramide synthase 1. Mutations in this gene are associated with several congenital cardiovascular malformations. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.