Human AMN/amnionless/PRO1028 ORF/cDNA clone-Lentivirus particle (NM_030943)
Cat. No.: vGMLP001763
Pre-made Human AMN/amnionless/PRO1028 Lentiviral expression plasmid for AMN lentivirus packaging, AMN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
AMN/amnionless products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001763 | Human AMN Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001763 |
| Gene Name | AMN |
| Accession Number | NM_030943 |
| Gene ID | 81693 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1362 bp |
| Gene Alias | amnionless,PRO1028 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGCGTCCTGGGCCGGGTCCTGCTGTGGCTGCAGCTCTGCGCACTGACCCAGGCGGTCTCCAAACTCTGGGTCCCCAACACGGACTTCGACGTCGCAGCCAACTGGAGCCAGAACCGGACCCCGTGCGCCGGCGGCGCCGTTGAGTTCCCGGCGGACAAGATGGTGTCAGTCCTGGTGCAAGAAGGTCACGCCGTCTCAGACATGCTCCTGCCGCTGGATGGGGAACTCGTCCTGGCTTCAGGAGCCGGATTCGGCGTCTCAGACGTGGGCTCGCACCTGGACTGTGGCGCGGGCGAACCTGCCGTCTTCCGCGACTCTGACCGCTTCTCCTGGCATGACCCGCACCTGTGGCGCTCTGGGGACGAGGCACCTGGCCTCTTCTTCGTGGACGCCGAGCGCGTGCCCTGCCGCCACGACGACGTCTTCTTTCCGCCTAGTGCCTCCTTCCGCGTGGGGCTCGGCCCTGGCGCTAGCCCCGTGCGTGTCCGCAGCATCTCGGCTCTGGGCCGGACGTTCACGCGCGACGAGGACCTGGCTGTTTTCCTGGCGTCCCGCGCGGGCCGCCTACGCTTCCACGGGCCGGGCGCGCTGAGCGTGGGCCCCGAGGACTGCGCGGACCCGTCGGGCTGCGTCTGCGGCAACGCGGAGGCGCAGCCGTGGATCTGCGCGGCCCTGCTCCAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCCGGCCCCAGGGGCAGTGCTGTGACCTCTGTGGAGCCGTTGTGTTGCTGACCCACGGCCCCGCATTTGACCTGGAGCGGTACCGGGCGCGGATACTGGACACCTTCCTGGGTCTGCCTCAGTACCACGGGCTGCAGGTGGCCGTGTCCAAGGTGCCACGCTCGTCCCGGCTCCGTGAGGCCGATACGGAGATCCAGGTGGTGCTGGTGGAGAATGGGCCCGAGACAGGCGGAGCGGGGCGGCTGGCCCGGGCCCTCCTGGCGGACGTCGCCGAGAACGGCGAGGCCCTCGGCGTCCTGGAGGCGACCATGCGGGAGTCGGGCGCACACGTCTGGGGCAGCTCCGCGGCTGGGCTGGCGGGCGGCGTGGCGGCTGCCGTGCTGCTGGCGCTGCTGGTCCTGCTGGTGGCGCCGCCGCTGCTGCGCCGCGCGGGGAGGCTCAGGTGGAGGAGGCACGAGGCGGCGGCCCCGGCTGGAGCGCCCCTCGGCTTCCGCAACCCGGTGTTCGACGTGACGGCCTCCGAGGAGCTGCCCCTGCCGCGGCGGCTCAGCCTGGTTCCGAAGGCGGCCGCAGACAGCACCAGCCACAGTTACTTCGTCAACCCTCTGTTCGCCGGGGCCGAGGCCGAGGCCTGA |
| ORF Protein Sequence | MGVLGRVLLWLQLCALTQAVSKLWVPNTDFDVAANWSQNRTPCAGGAVEFPADKMVSVLVQEGHAVSDMLLPLDGELVLASGAGFGVSDVGSHLDCGAGEPAVFRDSDRFSWHDPHLWRSGDEAPGLFFVDAERVPCRHDDVFFPPSASFRVGLGPGASPVRVRSISALGRTFTRDEDLAVFLASRAGRLRFHGPGALSVGPEDCADPSGCVCGNAEAQPWICAALLQPLGGRCPQAACHSALRPQGQCCDLCGAVVLLTHGPAFDLERYRARILDTFLGLPQYHGLQVAVSKVPRSSRLREADTEIQVVLVENGPETGGAGRLARALLADVAENGEALGVLEATMRESGAHVWGSSAAGLAGGVAAAVLLALLVLLVAPPLLRRAGRLRWRRHEAAAPAGAPLGFRNPVFDVTASEELPLPRRLSLVPKAAADSTSHSYFVNPLFAGAEAEA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0058-Ab | Anti-AMNLS/ AMN/ PRO1028 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0058-Ag | AMN VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001763 | Human AMN Lentivirus plasmid |
| ORF Viral Vector | vGMLP001763 | Human AMN Lentivirus particle |
Target information
| Target ID | GM-MP0058 |
| Target Name | AMN |
| Gene ID | 81693, 93835, 106999578, 314459, 101084117, 403434, 767976, 106782539 |
| Gene Symbol and Synonyms | AMN,amnionless,IGS2,PRO1028 |
| Uniprot Accession | Q9BXJ7 |
| Uniprot Entry Name | AMNLS_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000166126 |
| Target Classification | Not Available |
The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


