Human ZP3/OOMD3/Zp-3 ORF/cDNA clone-Lentivirus particle (NM_001110354)
Cat. No.: vGMLP001806
Pre-made Human ZP3/OOMD3/Zp-3 Lentiviral expression plasmid for ZP3 lentivirus packaging, ZP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ZP3/OOMD3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001806 | Human ZP3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001806 |
| Gene Name | ZP3 |
| Accession Number | NM_001110354 |
| Gene ID | 7784 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1275 bp |
| Gene Alias | OOMD3,Zp-3,ZP3A,ZP3B,ZPC |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGCTGAGCTATAGGCTCTTCATCTGCCTCCTGCTCTGGGGTAGTACTGAGCTGTGCTACCCCCAACCCCTCTGGCTCTTGCAGGGTGGAGCCAGCCATCCTGAGACGTCCGTACAGCCCGTACTGGTGGAGTGTCAGGAGGCCACTCTGATGGTCATGGTCAGCAAAGACCTTTTTGGCACCGGGAAGCTCATCAGGGCTGCTGACCTCACCTTGGGCCCAGAGGCCTGTGAGCCTCTGGTCTCCATGGACACAGAAGATGTGGTCAGGTTTGAGGTTGGACTCCACGAGTGTGGCAACAGCATGCAGGTAACTGACGATGCCCTGGTGTACAGCACCTTCCTGCTCCATGACCCCCGCCCCGTGGGAAACCTGTCCATCGTGAGGACTAACCGCGCAGAGATTCCCATCGAGTGCCGCTACCCCAGGCAGGGCAATGTGAGCAGCCAGGCCATCCTGCCCACCTGGTTGCCCTTCAGGACCACGGTGTTCTCAGAGGAGAAGCTGACTTTCTCTCTGCGTCTGATGGAGGAGAACTGGAACGCTGAGAAGAGGTCCCCCACCTTCCACCTGGGAGATGCAGCCCACCTCCAGGCAGAAATCCACACTGGCAGCCACGTGCCACTGCGGTTGTTTGTGGACCACTGCGTGGCCACACCGACACCAGACCAGAATGCCTCCCCTTATCACACCATCGTGGACTTCCATGGCTGTCTTGTCGACGGTCTCACTGATGCCTCTTCTGCATTCAAAGTTCCTCGACCCGGGCCAGATACACTCCAGTTCACAGTGGATGTCTTCCACTTTGCTAATGACTCCAGAAACATGATATACATCACCTGCCACCTGAAGGTCACCCTAGCTGAGCAGGACCCAGATGAACTCAACAAGGCCTGTTCCTTCAGCAAGCCTTCCAACAGCTGGTTCCCAGTGGAAGGCTCGGCTGACATCTGTCAATGCTGTAACAAAGGTGACTGTGGCACTCCAAGCCATTCCAGGAGGCAGCCTCATGTCATGAGCCAGTGGTCCAGGTCTGCTTCCCGTAACCGCAGGCATGTGACAGAAGAAGCAGATGTCACCGTGGGGCCACTGATCTTCCTGGACAGGAGGGGTGACCATGAAGTAGAGCAGTGGGCTTTGCCTTCTGACACCTCAGTGGTGCTGCTGGGCGTAGGCCTGGCTGTGGTGGTGTCCCTGACTCTGACTGCTGTTATCCTGGTTCTCACCAGGAGGTGTCGCACTGCCTCCCACCCTGTGTCTGCTTCCGAATAA |
| ORF Protein Sequence | MELSYRLFICLLLWGSTELCYPQPLWLLQGGASHPETSVQPVLVECQEATLMVMVSKDLFGTGKLIRAADLTLGPEACEPLVSMDTEDVVRFEVGLHECGNSMQVTDDALVYSTFLLHDPRPVGNLSIVRTNRAEIPIECRYPRQGNVSSQAILPTWLPFRTTVFSEEKLTFSLRLMEENWNAEKRSPTFHLGDAAHLQAEIHTGSHVPLRLFVDHCVATPTPDQNASPYHTIVDFHGCLVDGLTDASSAFKVPRPGPDTLQFTVDVFHFANDSRNMIYITCHLKVTLAEQDPDELNKACSFSKPSNSWFPVEGSADICQCCNKGDCGTPSHSRRQPHVMSQWSRSASRNRRHVTEEADVTVGPLIFLDRRGDHEVEQWALPSDTSVVLLGVGLAVVVSLTLTAVILVLTRRCRTASHPVSASE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IO155-Ab | Anti-ZP3/ OOMD3A/ ZP3B monoclonal antibody |
| Target Antigen | GM-Tg-g-IO155-Ag | ZP3 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001806 | Human ZP3 Lentivirus plasmid |
| ORF Viral Vector | vGMLP001806 | Human ZP3 Lentivirus particle |
Target information
| Target ID | GM-IO155 |
| Target Name | ZP3 |
| Gene ID | 7784, 22788, 719925, 114639, 493925, 403894, 280964, 100060941 |
| Gene Symbol and Synonyms | OOMD3,OZEMA3,Zp-3,Zp-3B,ZP3,ZP3A,ZP3B,ZPC |
| Uniprot Accession | P21754 |
| Uniprot Entry Name | ZP3_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000188372 |
| Target Classification | Checkpoint-Immuno Oncology |
The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


