Human ZP3/OOMD3/Zp-3 ORF/cDNA clone-Lentivirus particle (NM_001110354)

Cat. No.: vGMLP001806

Pre-made Human ZP3/OOMD3/Zp-3 Lentiviral expression plasmid for ZP3 lentivirus packaging, ZP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ZP3/OOMD3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001806 Human ZP3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001806
Gene Name ZP3
Accession Number NM_001110354
Gene ID 7784
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1275 bp
Gene Alias OOMD3,Zp-3,ZP3A,ZP3B,ZPC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCTGAGCTATAGGCTCTTCATCTGCCTCCTGCTCTGGGGTAGTACTGAGCTGTGCTACCCCCAACCCCTCTGGCTCTTGCAGGGTGGAGCCAGCCATCCTGAGACGTCCGTACAGCCCGTACTGGTGGAGTGTCAGGAGGCCACTCTGATGGTCATGGTCAGCAAAGACCTTTTTGGCACCGGGAAGCTCATCAGGGCTGCTGACCTCACCTTGGGCCCAGAGGCCTGTGAGCCTCTGGTCTCCATGGACACAGAAGATGTGGTCAGGTTTGAGGTTGGACTCCACGAGTGTGGCAACAGCATGCAGGTAACTGACGATGCCCTGGTGTACAGCACCTTCCTGCTCCATGACCCCCGCCCCGTGGGAAACCTGTCCATCGTGAGGACTAACCGCGCAGAGATTCCCATCGAGTGCCGCTACCCCAGGCAGGGCAATGTGAGCAGCCAGGCCATCCTGCCCACCTGGTTGCCCTTCAGGACCACGGTGTTCTCAGAGGAGAAGCTGACTTTCTCTCTGCGTCTGATGGAGGAGAACTGGAACGCTGAGAAGAGGTCCCCCACCTTCCACCTGGGAGATGCAGCCCACCTCCAGGCAGAAATCCACACTGGCAGCCACGTGCCACTGCGGTTGTTTGTGGACCACTGCGTGGCCACACCGACACCAGACCAGAATGCCTCCCCTTATCACACCATCGTGGACTTCCATGGCTGTCTTGTCGACGGTCTCACTGATGCCTCTTCTGCATTCAAAGTTCCTCGACCCGGGCCAGATACACTCCAGTTCACAGTGGATGTCTTCCACTTTGCTAATGACTCCAGAAACATGATATACATCACCTGCCACCTGAAGGTCACCCTAGCTGAGCAGGACCCAGATGAACTCAACAAGGCCTGTTCCTTCAGCAAGCCTTCCAACAGCTGGTTCCCAGTGGAAGGCTCGGCTGACATCTGTCAATGCTGTAACAAAGGTGACTGTGGCACTCCAAGCCATTCCAGGAGGCAGCCTCATGTCATGAGCCAGTGGTCCAGGTCTGCTTCCCGTAACCGCAGGCATGTGACAGAAGAAGCAGATGTCACCGTGGGGCCACTGATCTTCCTGGACAGGAGGGGTGACCATGAAGTAGAGCAGTGGGCTTTGCCTTCTGACACCTCAGTGGTGCTGCTGGGCGTAGGCCTGGCTGTGGTGGTGTCCCTGACTCTGACTGCTGTTATCCTGGTTCTCACCAGGAGGTGTCGCACTGCCTCCCACCCTGTGTCTGCTTCCGAATAA
ORF Protein Sequence MELSYRLFICLLLWGSTELCYPQPLWLLQGGASHPETSVQPVLVECQEATLMVMVSKDLFGTGKLIRAADLTLGPEACEPLVSMDTEDVVRFEVGLHECGNSMQVTDDALVYSTFLLHDPRPVGNLSIVRTNRAEIPIECRYPRQGNVSSQAILPTWLPFRTTVFSEEKLTFSLRLMEENWNAEKRSPTFHLGDAAHLQAEIHTGSHVPLRLFVDHCVATPTPDQNASPYHTIVDFHGCLVDGLTDASSAFKVPRPGPDTLQFTVDVFHFANDSRNMIYITCHLKVTLAEQDPDELNKACSFSKPSNSWFPVEGSADICQCCNKGDCGTPSHSRRQPHVMSQWSRSASRNRRHVTEEADVTVGPLIFLDRRGDHEVEQWALPSDTSVVLLGVGLAVVVSLTLTAVILVLTRRCRTASHPVSASE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IO155-Ab Anti-ZP3/ OOMD3A/ ZP3B monoclonal antibody
    Target Antigen GM-Tg-g-IO155-Ag ZP3 VLP (virus-like particle)
    ORF Viral Vector pGMLP001806 Human ZP3 Lentivirus plasmid
    ORF Viral Vector vGMLP001806 Human ZP3 Lentivirus particle


    Target information

    Target ID GM-IO155
    Target Name ZP3
    Gene ID 7784, 22788, 719925, 114639, 493925, 403894, 280964, 100060941
    Gene Symbol and Synonyms OOMD3,OZEMA3,Zp-3,Zp-3B,ZP3,ZP3A,ZP3B,ZPC
    Uniprot Accession P21754
    Uniprot Entry Name ZP3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000188372
    Target Classification Checkpoint-Immuno Oncology

    The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.