Human PRCD/RP36 ORF/cDNA clone-Lentivirus particle (NM_001077620)

Pre-made Human PRCD/RP36 Lentiviral expression plasmid for PRCD lentivirus packaging, PRCD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to PRCD/RP36 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001835 Human PRCD Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001835
Gene Name PRCD
Accession Number NM_001077620
Gene ID 768206
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 165 bp
Gene Alias RP36
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGCACCACCCTTTTCCTGCTCAGCACCCTGGCCATGCTCTGGCGCCGCCGATTTGCCAACCGAGTCCAACCAGAGCCCAGCGACGTGGATGGGGCAGCTAGGGGCAGCAGCTTGGATGCGGACCCTCAGTCCTCAGGCAGGGAGAAAGAACCTCTGAAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1657-Ab Anti-PRCD/ RP36 functional antibody
    Target Antigen GM-Tg-g-SE1657-Ag PRCD protein
    ORF Viral Vector pGMLP001835 Human PRCD Lentivirus plasmid
    ORF Viral Vector vGMLP001835 Human PRCD Lentivirus particle


    Target information

    Target ID GM-SE1657
    Target Name PRCD
    Gene ID 768206, 100038570, 106994137, 100912216, 101085163, 100049006, 100051104
    Gene Symbol and Synonyms Gm11744,PRCD,RP36
    Uniprot Accession Q00LT1
    Uniprot Entry Name PRCD_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000214140
    Target Classification Not Available

    This gene is predominantly expressed in the retina, and mutations in this gene are the cause of autosomal recessive retinal degeneration in both humans and dogs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.