Human SFTPA1/COLEC4/ PSAP ORF/cDNA clone-Lentivirus particle (NM_005411)
Pre-made Human SFTPA1/COLEC4/ PSAP Lentiviral expression plasmid for SFTPA1 lentivirus packaging, SFTPA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SFTPA1/COLEC4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001846 | Human SFTPA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001846 |
Gene Name | SFTPA1 |
Accession Number | NM_005411 |
Gene ID | 653509 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 747 bp |
Gene Alias | COLEC4, PSAP, PSP-A, PSPA, SFTP1, SFTPA1B, SP-A, SP-A1, SPA, SPA1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGGCTGTGCCCTCTGGCCCTCAACCTCATCTTGATGGCAGCCTCTGGTGCTGTGTGCGAAGTGAAGGACGTTTGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGCCTGCCAGGCAGGGACGGGAGAGATGGTCTCAAAGGAGACCCTGGCCCTCCAGGCCCCATGGGTCCACCTGGAGAAATGCCATGTCCTCCTGGAAATGATGGGCTGCCTGGAGCCCCTGGTATCCCTGGAGAGTGTGGAGAGAAGGGGGAGCCTGGCGAGAGGGGCCCTCCAGGGCTTCCAGCTCATCTAGATGAGGAGCTCCAAGCCACACTCCACGACTTTAGACATCAAATCCTGCAGACAAGGGGAGCCCTCAGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCCAGCAATGGGCAGTCCATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGCCGCATTGCTGTCCCAAGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAGTACAACACATATGCCTATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTACTCAGACGGGACCCCTGTAAACTACACCAACTGGTACCGAGGGGAGCCCGCAGGTCGGGGAAAAGAGCAGTGTGTGGAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTACTCCCGACTGACCATCTGTGAGTTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1287-Ab | Anti-SFTA1/ SFTPA1/ COLEC4 functional antibody |
Target Antigen | GM-Tg-g-SE1287-Ag | SFTPA1 protein |
ORF Viral Vector | pGMLP001846 | Human SFTPA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001846 | Human SFTPA1 Lentivirus particle |
Target information
Target ID | GM-SE1287 |
Target Name | SFTPA1 |
Gene ID | 653509 |
Gene Symbol and Synonyms | COLEC4,ILD1,PSAP,PSP-A,PSPA,SFTP1,SFTPA1,SFTPA1B,SP-A,SP-A1,SP-A1 beta,SP-A1 delta,SP-A1 epsilon,SP-A1 gamma,SPA,SPA1 |
Uniprot Accession | Q8IWL2 |
Uniprot Entry Name | SFTA1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker |
Disease | Not Available |
Gene Ensembl | ENSG00000122852 |
Target Classification | Not Available |
This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.