Human CX3CL1/ABCD-3/ C3Xkine ORF/cDNA clone-Lentivirus particle (NM_002996.5)

Pre-made Human CX3CL1/ABCD-3/ C3Xkine Lentiviral expression plasmid for CX3CL1 lentivirus packaging, CX3CL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CX3CL1/ABCD-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001884 Human CX3CL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001884
Gene Name CX3CL1
Accession Number NM_002996.5
Gene ID 6376
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1194 bp
Gene Alias ABCD-3, C3Xkine, CXC3, CXC3C, fractalkine, neurotactin, NTN, NTT, SCYD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTCCGATATCTCTGTCGTGGCTGCTCCGCTTGGCCACCTTCTGCCATCTGACTGTCCTGCTGGCTGGACAGCACCACGGTGTGACGAAATGCAACATCACGTGCAGCAAGATGACATCAAAGATACCTGTAGCTTTGCTCATCCACTATCAACAGAACCAGGCATCATGCGGCAAACGCGCAATCATCTTGGAGACGAGACAGCACAGGCTGTTCTGTGCCGACCCGAAGGAGCAATGGGTCAAGGACGCGATGCAGCATCTGGACCGCCAGGCTGCTGCCCTAACTCGAAATGGCGGCACCTTCGAGAAGCAGATCGGCGAGGTGAAGCCCAGGACCACCCCTGCCGCCGGGGGAATGGACGAGTCTGTGGTCCTGGAGCCCGAAGCCACAGGCGAAAGCAGTAGCCTGGAGCCGACTCCTTCTTCCCAGGAAGCACAGAGGGCCCTGGGGACCTCCCCAGAGCTGCCGACGGGCGTGACTGGTTCCTCAGGGACCAGGCTCCCCCCGACGCCAAAGGCTCAGGATGGAGGGCCTGTGGGCACGGAGCTTTTCCGAGTGCCTCCCGTCTCCACTGCCGCCACGTGGCAGAGTTCTGCTCCCCACCAACCTGGGCCCAGCCTCTGGGCTGAGGCAAAGACCTCTGAGGCCCCGTCCACCCAGGACCCCTCCACCCAGGCCTCCACTGCGTCCTCCCCAGCCCCAGAGGAGAATGCTCCGTCTGAAGGCCAGCGTGTGTGGGGTCAGGGACAGAGCCCCAGGCCAGAGAACTCTCTGGAGCGGGAGGAGATGGGTCCCGTGCCAGCGCACACGGATGCCTTCCAGGACTGGGGGCCTGGCAGCATGGCCCACGTCTCTGTGGTCCCTGTCTCCTCAGAAGGGACCCCCAGCAGGGAGCCAGTGGCTTCAGGCAGCTGGACCCCTAAGGCTGAGGAACCCATCCATGCCACCATGGACCCCCAGAGGCTGGGCGTCCTTATCACTCCTGTCCCTGACGCCCAGGCTGCCACCCGGAGGCAGGCGGTGGGGCTGCTGGCCTTCCTTGGCCTCCTCTTCTGCCTGGGGGTGGCCATGTTCACCTACCAGAGCCTCCAGGGCTGCCCTCGAAAGATGGCAGGAGAGATGGCGGAGGGCCTTCGCTACATCCCCCGGAGCTGTGGTAGTAATTCATATGTCCTGGTGCCCGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-461 Pre-Made Quetmolimab biosimilar, Whole mAb, Anti-CX3CL1 Antibody: Anti-ABCD-3/C3Xkine/CXC3/CXC3C/NTN/NTT/SCYD1/fractalkine/neurotactin therapeutic antibody
    Target Antibody GM-Tg-g-T34405-Ab Anti-X3CL1/ CX3CL1/ ABCD-3 monoclonal antibody
    Target Antigen GM-Tg-g-T34405-Ag CX3CL1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T34405 chemokine (C-X3-C motif) ligand 1 (CX3CL1) protein & antibody
    ORF Viral Vector pGMLV000860 Human CX3CL1 Lentivirus plasmid
    ORF Viral Vector pGMAD001115 Rat Cx3cl1 Adenovirus plasmid
    ORF Viral Vector pGMLP001884 Human CX3CL1 Lentivirus plasmid
    ORF Viral Vector vGMLV000860 Human CX3CL1 Lentivirus particle
    ORF Viral Vector vGMAD001115 Rat Cx3cl1 Adenovirus particle
    ORF Viral Vector vGMLP001884 Human CX3CL1 Lentivirus particle


    Target information

    Target ID GM-T34405
    Target Name CX3CL1
    Gene ID 6376, 20312, 574225, 89808, 101084670, 487265, 517354, 102150350
    Gene Symbol and Synonyms ABCD-3,C3Xkine,CX3C,CX3CL1,CXC3,CXC3C,D8Bwg0439e,FK,fractalkine,neurotactin,NTN,NTT,SCYD1
    Uniprot Accession P78423
    Uniprot Entry Name X3CL1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000006210
    Target Classification Tumor-associated antigen (TAA)

    This gene belongs to the CX3C subgroup of chemokines, characterized by the number of amino acids located between the conserved cysteine residues. This is the only member of the CX3C subgroup, which contains three amino acids between cysteine residues, resulting in a Cys-X-X-X-Cys configuration. The encoded protein contains an extended mucin-like stalk with a chemokine domain on top, and exists in both a membrane-anchored form where it acts as a binding molecule, or, in soluble form, as a chemotactic cytokine. The mature form of this protein can be cleaved at the cell surface, yielding different soluble forms that can interact with the G-protein coupled receptor, C-X3-C motif chemokine receptor 1 gene product. This gene plays a role in a wide range of diseases, including cancer, vasculitis, neuropathies, atherosclerosis, inflammatory diseases, and in human immunodeficiency virus infections. [provided by RefSeq, Sep 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.