Human FSTL1/FRP/ FSL1 ORF/cDNA clone-Lentivirus particle (NM_007085.4)

Pre-made Human FSTL1/FRP/ FSL1 Lentiviral expression plasmid for FSTL1 lentivirus packaging, FSTL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FSTL1/FRP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001890 Human FSTL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001890
Gene Name FSTL1
Accession Number NM_007085.4
Gene ID 11167
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 927 bp
Gene Alias FRP, FSL1, MIR198, OCC-1, OCC1, tsc36
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGGAAACGCTGGCTCGCGCTCGCGCTCGCGCTGGTGGCGGTCGCCTGGGTCCGCGCCGAGGAAGAGCTAAGGAGCAAATCCAAGATCTGTGCCAATGTGTTTTGTGGAGCCGGCCGGGAATGTGCAGTCACAGAGAAAGGGGAACCCACCTGTCTCTGCATTGAGCAATGCAAACCTCACAAGAGGCCTGTGTGTGGCAGTAATGGCAAGACCTACCTCAACCACTGTGAACTGCATCGAGATGCCTGCCTCACTGGATCCAAAATCCAGGTTGATTACGATGGACACTGCAAAGAGAAGAAATCCGTAAGTCCATCTGCCAGCCCAGTTGTTTGCTATCAGTCCAACCGTGATGAGCTCCGACGTCGCATCATCCAGTGGCTGGAAGCTGAGATCATTCCAGATGGCTGGTTCTCTAAAGGCAGCAACTACAGTGAAATCCTAGACAAGTATTTTAAGAACTTTGATAATGGTGATTCTCGCCTGGACTCCAGTGAATTCCTGAAGTTTGTGGAACAGAATGAAACTGCCATCAATATTACAACGTATCCAGACCAGGAGAACAACAAGTTGCTTAGGGGACTCTGTGTTGATGCTCTCATTGAACTGTCTGATGAAAATGCTGATTGGAAACTCAGCTTCCAAGAGTTTCTCAAGTGCCTCAACCCATCTTTCAACCCTCCTGAGAAGAAGTGTGCCCTGGAGGATGAAACGTATGCAGATGGAGCTGAGACCGAGGTGGACTGTAACCGCTGTGTCTGTGCCTGTGGAAATTGGGTCTGTACAGCCATGACCTGTGACGGAAAGAATCAGAAGGGGGCCCAGACCCAGACAGAGGAGGAGATGACCAGATATGTCCAGGAGCTCCAAAAGCATCAGGAAACAGCTGAAAAGACCAAGAGAGTGAGCACCAAAGAGATCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0225-Ab Anti-FSTL1/ FRP/ FSL1 functional antibody
    Target Antigen GM-Tg-g-SE0225-Ag FSTL1 protein
    Cytokine cks-Tg-g-GM-SE0225 follistatin-like 1 (FSTL1) protein & antibody
    ORF Viral Vector pGMLV001301 Human FSTL1 Lentivirus plasmid
    ORF Viral Vector pGMLP001890 Human FSTL1 Lentivirus plasmid
    ORF Viral Vector vGMLV001301 Human FSTL1 Lentivirus particle
    ORF Viral Vector vGMLP001890 Human FSTL1 Lentivirus particle


    Target information

    Target ID GM-SE0225
    Target Name FSTL1
    Gene ID 11167, 14314, 713367, 79210, 101082337, 608384, 534482, 100070833
    Gene Symbol and Synonyms FRP,FSL1,Fstl,FSTL1,MIR198,OCC-1,OCC1,TSC-36,tsc36
    Uniprot Accession Q12841
    Uniprot Entry Name FSTL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000163430
    Target Classification Not Available

    This gene encodes a protein with similarity to follistatin, an activin-binding protein. It contains an FS module, a follistatin-like sequence containing 10 conserved cysteine residues. This gene product is thought to be an autoantigen associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.