Human PTH/PTH1 ORF/cDNA clone-Lentivirus particle (NM_000315.3)

Pre-made Human PTH/PTH1 Lentiviral expression plasmid for PTH lentivirus packaging, PTH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to PTH/PTH1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001900 Human PTH Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001900
Gene Name PTH
Accession Number NM_000315.3
Gene ID 5741
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 348 bp
Gene Alias PTH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATACCTGCAAAAGACATGGCTAAAGTTATGATTGTCATGTTGGCAATTTGTTTTCTTACAAAATCGGATGGGAAATCTGTTAAGAAGAGATCTGTGAGTGAAATACAGCTTATGCATAACCTGGGAAAACATCTGAACTCGATGGAGAGAGTAGAATGGCTGCGTAAGAAGCTGCAGGATGTGCACAATTTTGTTGCCCTTGGAGCTCCTCTAGCTCCCAGAGATGCTGGTTCCCAGAGGCCCCGAAAAAAGGAAGACAATGTCTTGGTTGAGAGCCATGAAAAAAGTCTTGGAGAGGCAGACAAAGCTGATGTGAATGTATTAACTAAAGCTAAATCCCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T98708-Ab Anti-PTHY/ PTH/ PTH1 functional antibody
    Target Antigen GM-Tg-g-T98708-Ag PTH protein
    ORF Viral Vector pGMLP001900 Human PTH Lentivirus plasmid
    ORF Viral Vector vGMLP001900 Human PTH Lentivirus particle


    Target information

    Target ID GM-T98708
    Target Name PTH
    Gene ID 5741, 19226, 700195, 24694, 493684, 403986, 280903, 100034104
    Gene Symbol and Synonyms FIH1,PTH,PTH-(1-84),PTH1,Pthp,Pthr1
    Uniprot Accession P01270
    Uniprot Entry Name PTHY_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000152266
    Target Classification Not Available

    This gene encodes a member of the parathyroid family of proteins. The encoded preproprotein is proteolytically processed to generate a protein that binds to the parathyroid hormone/parathyroid hormone-related peptide receptor and regulates blood calcium and phosphate levels. Excess production of the encoded protein, known as hyperparathyroidism, can result in hypercalcemia and kidney stones. On the other hand, defective processing of the encoded protein may lead to hypoparathyroidism, which can result in hypocalcemia and numbness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.