Human RBP4/MCOPCB10/ RDCCAS ORF/cDNA clone-Lentivirus particle (NM_006744.3 )
Pre-made Human RBP4/MCOPCB10/ RDCCAS Lentiviral expression plasmid for RBP4 lentivirus packaging, RBP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RBP4/MCOPCB10 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001901 | Human RBP4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001901 |
Gene Name | RBP4 |
Accession Number | NM_006744.3 |
Gene ID | 5950 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 606 bp |
Gene Alias | MCOPCB10, RDCCAS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGTGGGTGTGGGCGCTCTTGCTGTTGGCGGCGCTGGGCAGCGGCCGCGCGGAGCGCGACTGCCGAGTGAGCAGCTTCCGAGTCAAGGAGAACTTCGACAAGGCTCGCTTCTCTGGGACCTGGTACGCCATGGCCAAGAAGGACCCCGAGGGCCTCTTTCTGCAGGACAACATCGTCGCGGAGTTCTCCGTGGACGAGACCGGCCAGATGAGCGCCACAGCCAAGGGCCGAGTCCGTCTTTTGAATAACTGGGACGTGTGCGCAGACATGGTGGGCACCTTCACAGACACCGAGGACCCTGCCAAGTTCAAGATGAAGTACTGGGGCGTAGCCTCCTTTCTCCAGAAAGGAAATGATGACCACTGGATCGTCGACACAGACTACGACACGTATGCCGTGCAGTACTCCTGCCGCCTCCTGAACCTCGATGGCACCTGTGCTGACAGCTACTCCTTCGTGTTTTCCCGGGACCCCAACGGCCTGCCCCCAGAAGCGCAGAAGATTGTAAGGCAGCGGCAGGAGGAGCTGTGCCTGGCCAGGCAGTACAGGCTGATCGTCCACAACGGTTACTGCGATGGCAGATCAGAAAGAAACCTTTTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T55703-Ab | Anti-RET4/ RBP4/ MCOPCB10 functional antibody |
Target Antigen | GM-Tg-g-T55703-Ag | RBP4 protein |
Cytokine | cks-Tg-g-GM-T55703 | retinol binding protein 4 (RBP4) protein & antibody |
ORF Viral Vector | pGMLP001901 | Human RBP4 Lentivirus plasmid |
ORF Viral Vector | vGMLP001901 | Human RBP4 Lentivirus particle |
Target information
Target ID | GM-T55703 |
Target Name | RBP4 |
Gene ID | 5950, 19662, 701270, 25703, 101094377, 477775, 281444 |
Gene Symbol and Synonyms | fCP1,MCOPCB10,PRBP,RBP,Rbp-4,RBP4,RBPA,RDCCAS |
Uniprot Accession | P02753 |
Uniprot Entry Name | RET4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Diagnostics Biomarker, Cytokine Target |
Disease | Lung Cancer, Complications of kidney transplant, Acute kidney failure, Chronic Kidney Disease, Dent disease, Diabetic Nephropathy, Nephrotic syndrome, Nephrotic syndrome with focal and segmental glomerular lesions, Perinatal necrotizing enterocolitis, Type 1 diabetes mellitus, Type 2 diabetes mellitus |
Gene Ensembl | ENSG00000138207 |
Target Classification | Not Available |
This protein belongs to the lipocalin family and is the specific carrier for retinol (vitamin A alcohol) in the blood. It delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP-retinol complex interacts with transthyretin which prevents its loss by filtration through the kidney glomeruli. A deficiency of vitamin A blocks secretion of the binding protein posttranslationally and results in defective delivery and supply to the epidermal cells. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.