Human RBP4/MCOPCB10/ RDCCAS ORF/cDNA clone-Lentivirus particle (NM_006744.3 )

Pre-made Human RBP4/MCOPCB10/ RDCCAS Lentiviral expression plasmid for RBP4 lentivirus packaging, RBP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to RBP4/MCOPCB10 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001901 Human RBP4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001901
Gene Name RBP4
Accession Number NM_006744.3
Gene ID 5950
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 606 bp
Gene Alias MCOPCB10, RDCCAS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGTGGGTGTGGGCGCTCTTGCTGTTGGCGGCGCTGGGCAGCGGCCGCGCGGAGCGCGACTGCCGAGTGAGCAGCTTCCGAGTCAAGGAGAACTTCGACAAGGCTCGCTTCTCTGGGACCTGGTACGCCATGGCCAAGAAGGACCCCGAGGGCCTCTTTCTGCAGGACAACATCGTCGCGGAGTTCTCCGTGGACGAGACCGGCCAGATGAGCGCCACAGCCAAGGGCCGAGTCCGTCTTTTGAATAACTGGGACGTGTGCGCAGACATGGTGGGCACCTTCACAGACACCGAGGACCCTGCCAAGTTCAAGATGAAGTACTGGGGCGTAGCCTCCTTTCTCCAGAAAGGAAATGATGACCACTGGATCGTCGACACAGACTACGACACGTATGCCGTGCAGTACTCCTGCCGCCTCCTGAACCTCGATGGCACCTGTGCTGACAGCTACTCCTTCGTGTTTTCCCGGGACCCCAACGGCCTGCCCCCAGAAGCGCAGAAGATTGTAAGGCAGCGGCAGGAGGAGCTGTGCCTGGCCAGGCAGTACAGGCTGATCGTCCACAACGGTTACTGCGATGGCAGATCAGAAAGAAACCTTTTGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T55703-Ab Anti-RET4/ RBP4/ MCOPCB10 functional antibody
    Target Antigen GM-Tg-g-T55703-Ag RBP4 protein
    Cytokine cks-Tg-g-GM-T55703 retinol binding protein 4 (RBP4) protein & antibody
    ORF Viral Vector pGMLP001901 Human RBP4 Lentivirus plasmid
    ORF Viral Vector vGMLP001901 Human RBP4 Lentivirus particle


    Target information

    Target ID GM-T55703
    Target Name RBP4
    Gene ID 5950, 19662, 701270, 25703, 101094377, 477775, 281444
    Gene Symbol and Synonyms fCP1,MCOPCB10,PRBP,RBP,Rbp-4,RBP4,RBPA,RDCCAS
    Uniprot Accession P02753
    Uniprot Entry Name RET4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker, Cytokine Target
    Disease Lung Cancer, Complications of kidney transplant, Acute kidney failure, Chronic Kidney Disease, Dent disease, Diabetic Nephropathy, Nephrotic syndrome, Nephrotic syndrome with focal and segmental glomerular lesions, Perinatal necrotizing enterocolitis, Type 1 diabetes mellitus, Type 2 diabetes mellitus
    Gene Ensembl ENSG00000138207
    Target Classification Not Available

    This protein belongs to the lipocalin family and is the specific carrier for retinol (vitamin A alcohol) in the blood. It delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP-retinol complex interacts with transthyretin which prevents its loss by filtration through the kidney glomeruli. A deficiency of vitamin A blocks secretion of the binding protein posttranslationally and results in defective delivery and supply to the epidermal cells. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.