Human PRKAR1A/ACRDYS1/ADOHR ORF/cDNA clone-Lentivirus particle (NM_212472.2)
Cat. No.: vGMLP001990
Pre-made Human PRKAR1A/ACRDYS1/ADOHR Lentiviral expression plasmid for PRKAR1A lentivirus packaging, PRKAR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PRKAR1A/ACRDYS1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001990 | Human PRKAR1A Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001990 |
| Gene Name | PRKAR1A |
| Accession Number | NM_212472.2 |
| Gene ID | 5573 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1146 bp |
| Gene Alias | ACRDYS1,ADOHR,CAR,CNC,CNC1,PKR1,PPNAD1,PRKAR1,TSE1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGTCTGGCAGTACCGCCGCCAGTGAGGAGGCACGCAGCCTTCGAGAATGTGAGCTCTACGTCCAGAAGCATAACATTCAAGCGCTGCTCAAAGATTCTATTGTGCAGTTGTGCACTGCTCGACCTGAGAGACCCATGGCATTCCTCAGGGAATACTTTGAGAGGTTGGAGAAGGAGGAGGCAAAACAGATTCAGAATCTGCAGAAAGCAGGCACTCGTACAGACTCAAGGGAGGATGAGATTTCTCCTCCTCCACCCAACCCAGTGGTTAAAGGTAGGAGGCGACGAGGTGCTATCAGCGCTGAGGTCTACACGGAGGAAGATGCGGCATCCTATGTTAGAAAGGTTATACCAAAAGATTACAAGACAATGGCCGCTTTAGCCAAAGCCATTGAAAAGAATGTGCTGTTTTCACATCTTGATGATAATGAGAGAAGTGATATTTTTGATGCCATGTTTTCGGTCTCCTTTATCGCAGGAGAGACTGTGATTCAGCAAGGTGATGAAGGGGATAACTTCTATGTGATTGATCAAGGAGAGACGGATGTCTATGTTAACAATGAATGGGCAACCAGTGTTGGGGAAGGAGGGAGCTTTGGAGAACTTGCTTTGATTTATGGAACACCGAGAGCAGCCACTGTCAAAGCAAAGACAAATGTGAAATTGTGGGGCATCGACCGAGACAGCTATAGAAGAATCCTCATGGGAAGCACACTGAGAAAGCGGAAGATGTATGAGGAATTCCTTAGTAAAGTCTCTATTTTAGAGTCTCTGGACAAGTGGGAACGTCTTACGGTAGCTGATGCATTGGAACCAGTGCAGTTTGAAGATGGGCAGAAGATTGTGGTGCAGGGAGAACCAGGGGATGAGTTCTTCATTATTTTAGAGGGGTCAGCTGCTGTGCTACAACGTCGGTCAGAAAATGAAGAGTTTGTTGAAGTGGGAAGATTGGGGCCTTCTGATTATTTTGGTGAAATTGCACTACTGATGAATCGTCCTCGTGCTGCCACAGTTGTTGCTCGTGGCCCCTTGAAGTGCGTTAAGCTGGACCGACCTAGATTTGAACGTGTTCTTGGCCCATGCTCAGACATCCTCAAACGAAACATCCAGCAGTACAACAGTTTTGTGTCACTGTCTGTCTGA |
| ORF Protein Sequence | MESGSTAASEEARSLRECELYVQKHNIQALLKDSIVQLCTARPERPMAFLREYFERLEKEEAKQIQNLQKAGTRTDSREDEISPPPPNPVVKGRRRRGAISAEVYTEEDAASYVRKVIPKDYKTMAALAKAIEKNVLFSHLDDNERSDIFDAMFSVSFIAGETVIQQGDEGDNFYVIDQGETDVYVNNEWATSVGEGGSFGELALIYGTPRAATVKAKTNVKLWGIDRDSYRRILMGSTLRKRKMYEEFLSKVSILESLDKWERLTVADALEPVQFEDGQKIVVQGEPGDEFFIILEGSAAVLQRRSENEEFVEVGRLGPSDYFGEIALLMNRPRAATVVARGPLKCVKLDRPRFERVLGPCSDILKRNIQQYNSFVSLSV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T08813-Ab | Anti-PRKAR1A monoclonal antibody |
| Target Antigen | GM-Tg-g-T08813-Ag | PRKAR1A protein |
| ORF Viral Vector | pGMLP001990 | Human PRKAR1A Lentivirus plasmid |
| ORF Viral Vector | pGMLP005414 | Human PRKAR1A Lentivirus plasmid |
| ORF Viral Vector | vGMLP001990 | Human PRKAR1A Lentivirus particle |
| ORF Viral Vector | vGMLP005414 | Human PRKAR1A Lentivirus particle |
Target information
| Target ID | GM-T08813 |
| Target Name | PRKAR1A |
| Gene ID | 5573, 19084, 719021, 25725, 101088632, 480459, 615074, 100053143 |
| Gene Symbol and Synonyms | 1300018C22Rik,ACRDYS1,ADOHR,CAR,CNC,CNC1,PKR1,PPNAD1,PRKAR1,PRKAR1A,RIalpha,RIIA,Tse-1,TSE1 |
| Uniprot Accession | P10644 |
| Uniprot Entry Name | KAP0_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000108946 |
| Target Classification | Tumor-associated antigen (TAA) |
cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed. [provided by RefSeq, Jan 2013]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


