Human PRKAR1A/ACRDYS1/ADOHR ORF/cDNA clone-Lentivirus particle (XM_011524985.2)

Cat. No.: vGMLP005414

Pre-made Human PRKAR1A/ACRDYS1/ADOHR Lentiviral expression plasmid for PRKAR1A lentivirus packaging, PRKAR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PRKAR1A/ACRDYS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005414 Human PRKAR1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005414
Gene Name PRKAR1A
Accession Number XM_011524985.2
Gene ID 5573
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1146 bp
Gene Alias ACRDYS1,ADOHR,CAR,CNC,CNC1,PKR1,PPNAD1,PRKAR1,TSE1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGTCTGGCAGTACCGCCGCCAGTGAGGAGGCACGCAGCCTTCGAGAATGTGAGCTCTACGTCCAGAAGCATAACATTCAAGCGCTGCTCAAAGATTCTATTGTGCAGTTGTGCACTGCTCGACCTGAGAGACCCATGGCATTCCTCAGGGAATACTTTGAGAGGTTGGAGAAGGAGGAGGCAAAACAGATTCAGAATCTGCAGAAAGCAGGCACTCGTACAGACTCAAGGGAGGATGAGATTTCTCCTCCTCCACCCAACCCAGTGGTTAAAGGTAGGAGGCGACGAGGTGCTATCAGCGCTGAGGTCTACACGGAGGAAGATGCGGCATCCTATGTTAGAAAGGTTATACCAAAAGATTACAAGACAATGGCCGCTTTAGCCAAAGCCATTGAAAAGAATGTGCTGTTTTCACATCTTGATGATAATGAGAGAAGTGATATTTTTGATGCCATGTTTTCGGTCTCCTTTATCGCAGGAGAGACTGTGATTCAGCAAGGTGATGAAGGGGATAACTTCTATGTGATTGATCAAGGAGAGACGGATGTCTATGTTAACAATGAATGGGCAACCAGTGTTGGGGAAGGAGGGAGCTTTGGAGAACTTGCTTTGATTTATGGAACACCGAGAGCAGCCACTGTCAAAGCAAAGACAAATGTGAAATTGTGGGGCATCGACCGAGACAGCTATAGAAGAATCCTCATGGGAAGCACACTGAGAAAGCGGAAGATGTATGAGGAATTCCTTAGTAAAGTCTCTATTTTAGAGTCTCTGGACAAGTGGGAACGTCTTACGGTAGCTGATGCATTGGAACCAGTGCAGTTTGAAGATGGGCAGAAGATTGTGGTGCAGGGAGAACCAGGGGATGAGTTCTTCATTATTTTAGAGGGGTCAGCTGCTGTGCTACAACGTCGGTCAGAAAATGAAGAGTTTGTTGAAGTGGGAAGATTGGGGCCTTCTGATTATTTTGGTGAAATTGCACTACTGATGAATCGTCCTCGTGCTGCCACAGTTGTTGCTCGTGGCCCCTTGAAGTGCGTTAAGCTGGACCGACCTAGATTTGAACGTGTTCTTGGCCCATGCTCAGACATCCTCAAACGAAACATCCAGCAGTACAACAGTTTTGTGTCACTGTCTGTCTGA
ORF Protein Sequence MESGSTAASEEARSLRECELYVQKHNIQALLKDSIVQLCTARPERPMAFLREYFERLEKEEAKQIQNLQKAGTRTDSREDEISPPPPNPVVKGRRRRGAISAEVYTEEDAASYVRKVIPKDYKTMAALAKAIEKNVLFSHLDDNERSDIFDAMFSVSFIAGETVIQQGDEGDNFYVIDQGETDVYVNNEWATSVGEGGSFGELALIYGTPRAATVKAKTNVKLWGIDRDSYRRILMGSTLRKRKMYEEFLSKVSILESLDKWERLTVADALEPVQFEDGQKIVVQGEPGDEFFIILEGSAAVLQRRSENEEFVEVGRLGPSDYFGEIALLMNRPRAATVVARGPLKCVKLDRPRFERVLGPCSDILKRNIQQYNSFVSLSV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T08813-Ab Anti-PRKAR1A monoclonal antibody
    Target Antigen GM-Tg-g-T08813-Ag PRKAR1A protein
    ORF Viral Vector pGMLP001990 Human PRKAR1A Lentivirus plasmid
    ORF Viral Vector pGMLP005414 Human PRKAR1A Lentivirus plasmid
    ORF Viral Vector vGMLP001990 Human PRKAR1A Lentivirus particle
    ORF Viral Vector vGMLP005414 Human PRKAR1A Lentivirus particle


    Target information

    Target ID GM-T08813
    Target Name PRKAR1A
    Gene ID 5573, 19084, 719021, 25725, 101088632, 480459, 615074, 100053143
    Gene Symbol and Synonyms 1300018C22Rik,ACRDYS1,ADOHR,CAR,CNC,CNC1,PKR1,PPNAD1,PRKAR1,PRKAR1A,RIalpha,RIIA,Tse-1,TSE1
    Uniprot Accession P10644
    Uniprot Entry Name KAP0_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000108946
    Target Classification Tumor-associated antigen (TAA)

    cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed. [provided by RefSeq, Jan 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.