Human F3/CD142/TF ORF/cDNA clone-Lentivirus particle (NM_001993)

Cat. No.: vGMLP002095

Pre-made Human F3/CD142/TF Lentiviral expression plasmid for F3 lentivirus packaging, F3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to F3/CD142 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002095 Human F3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002095
Gene Name F3
Accession Number NM_001993
Gene ID 2152
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 888 bp
Gene Alias CD142,TF,TFA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGACCCCTGCCTGGCCCCGGGTCCCGCGCCCCGAGACCGCCGTCGCTCGGACGCTCCTGCTCGGCTGGGTCTTCGCCCAGGTGGCCGGCGCTTCAGGCACTACAAATACTGTGGCAGCATATAATTTAACTTGGAAATCAACTAATTTCAAGACAATTTTGGAGTGGGAACCCAAACCCGTCAATCAAGTCTACACTGTTCAAATAAGCACTAAGTCAGGAGATTGGAAAAGCAAATGCTTTTACACAACAGACACAGAGTGTGACCTCACCGACGAGATTGTGAAGGATGTGAAGCAGACGTACTTGGCACGGGTCTTCTCCTACCCGGCAGGGAATGTGGAGAGCACCGGTTCTGCTGGGGAGCCTCTGTATGAGAACTCCCCAGAGTTCACACCTTACCTGGAGACAAACCTCGGACAGCCAACAATTCAGAGTTTTGAACAGGTGGGAACAAAAGTGAATGTGACCGTAGAAGATGAACGGACTTTAGTCAGAAGGAACAACACTTTCCTAAGCCTCCGGGATGTTTTTGGCAAGGACTTAATTTATACACTTTATTATTGGAAATCTTCAAGTTCAGGAAAGAAAACAGCCAAAACAAACACTAATGAGTTTTTGATTGATGTGGATAAAGGAGAAAACTACTGTTTCAGTGTTCAAGCAGTGATTCCCTCCCGAACAGTTAACCGGAAGAGTACAGACAGCCCGGTAGAGTGTATGGGCCAGGAGAAAGGGGAATTCAGAGAAATATTCTACATCATTGGAGCTGTGGTATTTGTGGTCATCATCCTTGTCATCATCCTGGCTATATCTCTACACAAGTGTAGAAAGGCAGGAGTGGGGCAGAGCTGGAAGGAGAACTCCCCACTGAATGTTTCATAA
ORF Protein Sequence METPAWPRVPRPETAVARTLLLGWVFAQVAGASGTTNTVAAYNLTWKSTNFKTILEWEPKPVNQVYTVQISTKSGDWKSKCFYTTDTECDLTDEIVKDVKQTYLARVFSYPAGNVESTGSAGEPLYENSPEFTPYLETNLGQPTIQSFEQVGTKVNVTVEDERTLVRRNNTFLSLRDVFGKDLIYTLYYWKSSSSGKKTAKTNTNEFLIDVDKGENYCFSVQAVIPSRTVNRKSTDSPVECMGQEKGEFREIFYIIGAVVFVVIILVIILAISLHKCRKAGVGQSWKENSPLNVS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-582 Pre-Made Tisotumab biosimilar, Whole mAb, Anti-F3 Antibody: Anti-CD142/TF/TFA therapeutic antibody
    Biosimilar GMP-Bios-INN-1024 Pre-Made Tisotumab Vedotin Biosimilar, Whole Mab Adc, Anti-F3 Antibody: Anti-CD142/TF/TFA therapeutic antibody Drug Conjugate
    Target Antibody GM-Tg-g-T72702-Ab Anti-TF/ F3/ CD142 monoclonal antibody
    Target Antigen GM-Tg-g-T72702-Ag F3 VLP (virus-like particle)
    ORF Viral Vector pGMLP002095 Human F3 Lentivirus plasmid
    ORF Viral Vector vGMLP002095 Human F3 Lentivirus particle


    Target information

    Target ID GM-T72702
    Target Name F3
    Gene ID 2152, 14066, 714456, 25584, 101082330, 490153, 280686, 100058506
    Gene Symbol and Synonyms CD142,Cf-3,Cf3,F3,TF,TFA
    Uniprot Accession P13726
    Uniprot Entry Name TF_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000117525
    Target Classification Not Available

    This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces, for example, on monocytes. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. Platelets and monocytes have been shown to express this coagulation factor under procoagulatory and proinflammatory stimuli, and a major role in HIV-associated coagulopathy has been described. Platelet-dependent monocyte expression of coagulation factor III has been described to be associated with Coronavirus Disease 2019 (COVID-19) severity and mortality. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Aug 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.