Human F3/CD142/TF ORF/cDNA clone-Lentivirus particle (NM_001993)
Cat. No.: vGMLP002095
Pre-made Human F3/CD142/TF Lentiviral expression plasmid for F3 lentivirus packaging, F3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
F3/CD142 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002095 | Human F3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002095 |
| Gene Name | F3 |
| Accession Number | NM_001993 |
| Gene ID | 2152 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 888 bp |
| Gene Alias | CD142,TF,TFA |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGACCCCTGCCTGGCCCCGGGTCCCGCGCCCCGAGACCGCCGTCGCTCGGACGCTCCTGCTCGGCTGGGTCTTCGCCCAGGTGGCCGGCGCTTCAGGCACTACAAATACTGTGGCAGCATATAATTTAACTTGGAAATCAACTAATTTCAAGACAATTTTGGAGTGGGAACCCAAACCCGTCAATCAAGTCTACACTGTTCAAATAAGCACTAAGTCAGGAGATTGGAAAAGCAAATGCTTTTACACAACAGACACAGAGTGTGACCTCACCGACGAGATTGTGAAGGATGTGAAGCAGACGTACTTGGCACGGGTCTTCTCCTACCCGGCAGGGAATGTGGAGAGCACCGGTTCTGCTGGGGAGCCTCTGTATGAGAACTCCCCAGAGTTCACACCTTACCTGGAGACAAACCTCGGACAGCCAACAATTCAGAGTTTTGAACAGGTGGGAACAAAAGTGAATGTGACCGTAGAAGATGAACGGACTTTAGTCAGAAGGAACAACACTTTCCTAAGCCTCCGGGATGTTTTTGGCAAGGACTTAATTTATACACTTTATTATTGGAAATCTTCAAGTTCAGGAAAGAAAACAGCCAAAACAAACACTAATGAGTTTTTGATTGATGTGGATAAAGGAGAAAACTACTGTTTCAGTGTTCAAGCAGTGATTCCCTCCCGAACAGTTAACCGGAAGAGTACAGACAGCCCGGTAGAGTGTATGGGCCAGGAGAAAGGGGAATTCAGAGAAATATTCTACATCATTGGAGCTGTGGTATTTGTGGTCATCATCCTTGTCATCATCCTGGCTATATCTCTACACAAGTGTAGAAAGGCAGGAGTGGGGCAGAGCTGGAAGGAGAACTCCCCACTGAATGTTTCATAA |
| ORF Protein Sequence | METPAWPRVPRPETAVARTLLLGWVFAQVAGASGTTNTVAAYNLTWKSTNFKTILEWEPKPVNQVYTVQISTKSGDWKSKCFYTTDTECDLTDEIVKDVKQTYLARVFSYPAGNVESTGSAGEPLYENSPEFTPYLETNLGQPTIQSFEQVGTKVNVTVEDERTLVRRNNTFLSLRDVFGKDLIYTLYYWKSSSSGKKTAKTNTNEFLIDVDKGENYCFSVQAVIPSRTVNRKSTDSPVECMGQEKGEFREIFYIIGAVVFVVIILVIILAISLHKCRKAGVGQSWKENSPLNVS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-582 | Pre-Made Tisotumab biosimilar, Whole mAb, Anti-F3 Antibody: Anti-CD142/TF/TFA therapeutic antibody |
| Biosimilar | GMP-Bios-INN-1024 | Pre-Made Tisotumab Vedotin Biosimilar, Whole Mab Adc, Anti-F3 Antibody: Anti-CD142/TF/TFA therapeutic antibody Drug Conjugate |
| Target Antibody | GM-Tg-g-T72702-Ab | Anti-TF/ F3/ CD142 monoclonal antibody |
| Target Antigen | GM-Tg-g-T72702-Ag | F3 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP002095 | Human F3 Lentivirus plasmid |
| ORF Viral Vector | vGMLP002095 | Human F3 Lentivirus particle |
Target information
| Target ID | GM-T72702 |
| Target Name | F3 |
| Gene ID | 2152, 14066, 714456, 25584, 101082330, 490153, 280686, 100058506 |
| Gene Symbol and Synonyms | CD142,Cf-3,Cf3,F3,TF,TFA |
| Uniprot Accession | P13726 |
| Uniprot Entry Name | TF_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, INN Index |
| Disease | Not Available |
| Gene Ensembl | ENSG00000117525 |
| Target Classification | Not Available |
This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces, for example, on monocytes. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. Platelets and monocytes have been shown to express this coagulation factor under procoagulatory and proinflammatory stimuli, and a major role in HIV-associated coagulopathy has been described. Platelet-dependent monocyte expression of coagulation factor III has been described to be associated with Coronavirus Disease 2019 (COVID-19) severity and mortality. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Aug 2020]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


