Human PPIB/CYP-S1/ CYPB ORF/cDNA clone-Lentivirus particle (NM_000942)

Pre-made Human PPIB/CYP-S1/ CYPB Lentiviral expression plasmid for PPIB lentivirus packaging, PPIB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to PPIB/CYP-S1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002164 Human PPIB Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002164
Gene Name PPIB
Accession Number NM_000942
Gene ID 5479
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 651 bp
Gene Alias CYP-S1, CYPB, HEL-S-39, OI9, SCYLP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T25847-Ab Anti-PPIB/ B/ CYP-S1 functional antibody
    Target Antigen GM-Tg-g-T25847-Ag PPIB protein
    ORF Viral Vector pGMLP002164 Human PPIB Lentivirus plasmid
    ORF Viral Vector vGMLP002164 Human PPIB Lentivirus particle


    Target information

    Target ID GM-T25847
    Target Name PPIB
    Gene ID 5479, 19035, 706757, 64367, 101087581, 478337, 281419, 100066834
    Gene Symbol and Synonyms Cphn-2,Cphn2,CyP-20b,CYP-S1,CYPB,HEL-S-39,OI9,PPIB,SCYLP
    Uniprot Accession P23284
    Uniprot Entry Name PPIB_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000166794
    Target Classification Not Available

    The protein encoded by this gene is a cyclosporine-binding protein and is mainly located within the endoplasmic reticulum. It is associated with the secretory pathway and released in biological fluids. This protein can bind to cells derived from T- and B-lymphocytes, and may regulate cyclosporine A-mediated immunosuppression. Variants have been identified in this protein that give rise to recessive forms of osteogenesis imperfecta. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.