Human PPIB/CYP-S1/CYPB ORF/cDNA clone-Lentivirus particle (NM_000942)
Cat. No.: vGMLP002164
Pre-made Human PPIB/CYP-S1/CYPB Lentiviral expression plasmid for PPIB lentivirus packaging, PPIB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PPIB/CYP-S1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002164 | Human PPIB Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002164 |
| Gene Name | PPIB |
| Accession Number | NM_000942 |
| Gene ID | 5479 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 651 bp |
| Gene Alias | CYP-S1,CYPB,HEL-S-39,OI9,SCYLP |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAG |
| ORF Protein Sequence | MLRLSERNMKVLLAAALIAGSVFFLLLPGPSAADEKKKGPKVTVKVYFDLRIGDEDVGRVIFGLFGKTVPKTVDNFVALATGEKGFGYKNSKFHRVIKDFMIQGGDFTRGDGTGGKSIYGERFPDENFKLKHYGPGWVSMANAGKDTNGSQFFITTVKTAWLDGKHVVFGKVLEGMEVVRKVESTKTDSRDKPLKDVIIADCGKIEVEKPFAIAKE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T25847-Ab | Anti-PPIB/ B/ CYP-S1 functional antibody |
| Target Antigen | GM-Tg-g-T25847-Ag | PPIB protein |
| ORF Viral Vector | pGMLP002164 | Human PPIB Lentivirus plasmid |
| ORF Viral Vector | pGMPC001690 | Human PPIB Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP002164 | Human PPIB Lentivirus particle |
Target information
| Target ID | GM-T25847 |
| Target Name | PPIB |
| Gene ID | 5479, 19035, 706757, 64367, 101087581, 478337, 281419, 100066834 |
| Gene Symbol and Synonyms | Cphn-2,Cphn2,CyP-20b,CYP-S1,CYPB,HEL-S-39,OI9,PPIB,SCYLP |
| Uniprot Accession | P23284 |
| Uniprot Entry Name | PPIB_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000166794 |
| Target Classification | Not Available |
The protein encoded by this gene is a cyclosporine-binding protein and is mainly located within the endoplasmic reticulum. It is associated with the secretory pathway and released in biological fluids. This protein can bind to cells derived from T- and B-lymphocytes, and may regulate cyclosporine A-mediated immunosuppression. Variants have been identified in this protein that give rise to recessive forms of osteogenesis imperfecta. [provided by RefSeq, Oct 2009]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


