Human RNASET2/bA514O12.3/ RNASE6PL ORF/cDNA clone-Lentivirus particle (NM_003730)

Pre-made Human RNASET2/bA514O12.3/ RNASE6PL Lentiviral expression plasmid for RNASET2 lentivirus packaging, RNASET2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to RNASET2/bA514O12.3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002180 Human RNASET2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002180
Gene Name RNASET2
Accession Number NM_003730
Gene ID 8635
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 771 bp
Gene Alias bA514O12.3, RNASE6PL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGCCCTGCAGCCCTGCGCGGGGCCCTGCTGGGCTGCCTCTGCCTGGCGTTGCTTTGCCTGGGCGGTGCGGACAAGCGCCTGCGTGACAACCATGAGTGGAAAAAACTAATTATGGTTCAGCACTGGCCTGAGACAGTATGCGAGAAAATTCAAAACGACTGTAGAGACCCTCCGGATTACTGGACAATACATGGACTATGGCCCGATAAAAGTGAAGGATGTAATAGATCGTGGCCCTTCAATTTAGAAGAGATTAAGGATCTTTTGCCAGAAATGAGGGCATACTGGCCTGACGTAATTCACTCGTTTCCCAATCGCAGCCGCTTCTGGAAGCATGAGTGGGAAAAGCATGGGACCTGCGCCGCCCAGGTGGATGCGCTCAACTCCCAGAAGAAGTACTTTGGCAGAAGCCTGGAACTCTACAGGGAGCTGGACCTCAACAGTGTGCTTCTAAAATTGGGGATAAAACCATCCATCAATTACTACCAAGTTGCAGATTTTAAAGATGCCCTTGCCAGAGTATATGGAGTGATACCCAAAATCCAGTGCCTTCCACCAAGCCAGGATGAGGAAGTACAGACAATTGGTCAGATAGAACTGTGCCTCACTAAGCAAGACCAGCAGCTGCAAAACTGCACCGAGCCGGGGGAGCAGCCGTCCCCCAAGCAGGAAGTCTGGCTGGCAAATGGGGCCGCCGAGAGCCGGGGTCTGAGAGTCTGTGAAGATGGCCCAGTCTTCTATCCCCCACCTAAAAAGACCAAGCATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1251-Ab Anti-RNT2/ RNASET2/ RNASE6PL functional antibody
    Target Antigen GM-Tg-g-SE1251-Ag RNASET2 protein
    ORF Viral Vector pGMLP002180 Human RNASET2 Lentivirus plasmid
    ORF Viral Vector vGMLP002180 Human RNASET2 Lentivirus particle


    Target information

    Target ID GM-SE1251
    Target Name RNASET2
    Gene ID 8635, 100037283, 706533, 292306, 101080386, 612451, 508245, 100055381
    Gene Symbol and Synonyms 0610007O07Rik,4833423A10Rik,4930532K22Rik,bA514O12.3,RNASE6PL,RNASET2,Rnaset2a
    Uniprot Accession O00584
    Uniprot Entry Name RNT2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000026297
    Target Classification Not Available

    This ribonuclease gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.