Human RNASET2/bA514O12.3/ RNASE6PL ORF/cDNA clone-Lentivirus particle (NM_003730)
Pre-made Human RNASET2/bA514O12.3/ RNASE6PL Lentiviral expression plasmid for RNASET2 lentivirus packaging, RNASET2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RNASET2/bA514O12.3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002180 | Human RNASET2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002180 |
Gene Name | RNASET2 |
Accession Number | NM_003730 |
Gene ID | 8635 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 771 bp |
Gene Alias | bA514O12.3, RNASE6PL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGCCCTGCAGCCCTGCGCGGGGCCCTGCTGGGCTGCCTCTGCCTGGCGTTGCTTTGCCTGGGCGGTGCGGACAAGCGCCTGCGTGACAACCATGAGTGGAAAAAACTAATTATGGTTCAGCACTGGCCTGAGACAGTATGCGAGAAAATTCAAAACGACTGTAGAGACCCTCCGGATTACTGGACAATACATGGACTATGGCCCGATAAAAGTGAAGGATGTAATAGATCGTGGCCCTTCAATTTAGAAGAGATTAAGGATCTTTTGCCAGAAATGAGGGCATACTGGCCTGACGTAATTCACTCGTTTCCCAATCGCAGCCGCTTCTGGAAGCATGAGTGGGAAAAGCATGGGACCTGCGCCGCCCAGGTGGATGCGCTCAACTCCCAGAAGAAGTACTTTGGCAGAAGCCTGGAACTCTACAGGGAGCTGGACCTCAACAGTGTGCTTCTAAAATTGGGGATAAAACCATCCATCAATTACTACCAAGTTGCAGATTTTAAAGATGCCCTTGCCAGAGTATATGGAGTGATACCCAAAATCCAGTGCCTTCCACCAAGCCAGGATGAGGAAGTACAGACAATTGGTCAGATAGAACTGTGCCTCACTAAGCAAGACCAGCAGCTGCAAAACTGCACCGAGCCGGGGGAGCAGCCGTCCCCCAAGCAGGAAGTCTGGCTGGCAAATGGGGCCGCCGAGAGCCGGGGTCTGAGAGTCTGTGAAGATGGCCCAGTCTTCTATCCCCCACCTAAAAAGACCAAGCATTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1251-Ab | Anti-RNT2/ RNASET2/ RNASE6PL functional antibody |
Target Antigen | GM-Tg-g-SE1251-Ag | RNASET2 protein |
ORF Viral Vector | pGMLP002180 | Human RNASET2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002180 | Human RNASET2 Lentivirus particle |
Target information
Target ID | GM-SE1251 |
Target Name | RNASET2 |
Gene ID | 8635, 100037283, 706533, 292306, 101080386, 612451, 508245, 100055381 |
Gene Symbol and Synonyms | 0610007O07Rik,4833423A10Rik,4930532K22Rik,bA514O12.3,RNASE6PL,RNASET2,Rnaset2a |
Uniprot Accession | O00584 |
Uniprot Entry Name | RNT2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000026297 |
Target Classification | Not Available |
This ribonuclease gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.