Human AGTR2/AT2/ ATGR2 ORF/cDNA clone-Lentivirus particle (NM_000686.4)
Pre-made Human AGTR2/AT2/ ATGR2 Lentiviral expression plasmid for AGTR2 lentivirus packaging, AGTR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to AGTR2/AT2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002255 | Human AGTR2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002255 |
Gene Name | AGTR2 |
Accession Number | NM_000686.4 |
Gene ID | 186 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1092 bp |
Gene Alias | AT2, ATGR2, MRX88 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGGGCAACTCCACCCTTGCCACTACTAGCAAAAACATTACCAGCGGTCTTCACTTCGGGCTTGTGAACATCTCTGGCAACAATGAGTCTACCTTGAACTGTTCACAGAAACCATCAGATAAGCATTTAGATGCAATTCCTATTCTTTACTACATTATATTTGTAATTGGATTTCTGGTCAATATTGTCGTGGTTACACTGTTTTGTTGTCAAAAGGGTCCTAAAAAGGTTTCTAGCATATACATCTTCAACCTCGCTGTGGCTGATTTACTCCTTTTGGCTACTCTTCCTCTATGGGCAACCTATTATTCTTATAGATATGACTGGCTCTTTGGACCTGTGATGTGCAAAGTTTTTGGTTCTTTTCTTACCCTGAACATGTTTGCAAGCATTTTTTTTATCACCTGCATGAGTGTTGATAGGTACCAATCTGTCATCTACCCCTTTCTGTCTCAAAGAAGAAATCCCTGGCAAGCATCTTATATAGTTCCCCTTGTTTGGTGTATGGCCTGTTTGTCCTCATTGCCAACATTTTATTTTCGAGACGTCAGAACCATTGAATACTTAGGAGTGAATGCTTGCATTATGGCTTTCCCACCTGAGAAATATGCCCAATGGTCAGCTGGGATTGCCTTAATGAAAAATATCCTTGGTTTTATTATCCCTTTAATATTCATAGCAACATGCTATTTTGGAATTAGAAAACACTTACTGAAGACGAATAGCTATGGGAAGAACAGGATAACCCGTGACCAAGTCCTGAAGATGGCAGCTGCTGTTGTTCTGGCCTTCATCATTTGCTGGCTTCCCTTCCATGTTCTGACCTTCCTGGATGCTCTGGCCTGGATGGGTGTCATTAATAGCTGCGAAGTTATAGCAGTCATTGACCTGGCACTTCCTTTTGCCATCCTCTTGGGATTCACCAACAGCTGCGTTAATCCGTTTCTGTATTGTTTTGTTGGAAACCGGTTCCAACAGAAGCTCCGCAGTGTGTTTAGGGTTCCAATTACTTGGCTCCAAGGGAAAAGAGAGAGTATGTCTTGCCGGAAAAGCAGTTCTCTTAGAGAAATGGAGACCTTTGTGTCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T09909-Ab | Anti-AGTR2/ AT2/ ATGR2 monoclonal antibody |
Target Antigen | GM-Tg-g-T09909-Ag | AGTR2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002255 | Human AGTR2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002255 | Human AGTR2 Lentivirus particle |
Target information
Target ID | GM-T09909 |
Target Name | AGTR2 |
Gene ID | 186, 11609, 709513, 24182, 101080516, 403835, 407157, 100053878 |
Gene Symbol and Synonyms | AGTR2,AT2,AT2-R,AT2R,AT2R,ATGR2,MRX88 |
Uniprot Accession | P50052 |
Uniprot Entry Name | AGTR2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000180772 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the G-protein coupled receptor 1 family, and functions as a receptor for angiotensin II. It is an intergral membrane protein that is highly expressed in fetus and in neonates, but scantily in adult tissues, except brain, adrenal medulla, and atretic ovary. This receptor has been shown to mediate programmed cell death and this apoptotic function may play an important role in developmental biology and pathophysiology. Mutations in this gene are been associated with X-linked cognitive disability. Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and SARS-CoV-2 infection results in down-regulation of angiotensin converting enzyme-2 (ACE2) receptors, the effects of which, triggers serious inflammatory lesions in the tissues involved, primarily in the lungs. The inflammatory reaction appears to be mediated by angiotensin II derivatives, including the angiotensin AT2 receptor which has been found to be upregulated in bronchoalveolar lavage samples from Coronavirus disease 2019 (COVID19) patients. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.