Human TFF2/SML1/ SP ORF/cDNA clone-Lentivirus particle (NM_005423)

Pre-made Human TFF2/SML1/ SP Lentiviral expression plasmid for TFF2 lentivirus packaging, TFF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to TFF2/SML1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002301 Human TFF2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002301
Gene Name TFF2
Accession Number NM_005423
Gene ID 7032
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 390 bp
Gene Alias SML1, SP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGACGGCGAGACGCCCAGCTCCTGGCAGCGCTCCTCGTCCTGGGGCTATGTGCCCTGGCGGGGAGTGAGAAACCCTCCCCCTGCCAGTGCTCCAGGCTGAGCCCCCATAACAGGACGAACTGCGGCTTCCCTGGAATCACCAGTGACCAGTGTTTTGACAATGGATGCTGTTTCGACTCCAGTGTCACTGGGGTCCCCTGGTGTTTCCACCCCCTCCCAAAGCAAGAGTCGGATCAGTGCGTCATGGAGGTCTCAGACCGAAGAAACTGTGGCTACCCGGGCATCAGCCCCGAGGAATGCGCCTCTCGGAAGTGCTGCTTCTCCAACTTCATCTTTGAAGTGCCCTGGTGCTTCTTCCCGAAGTCTGTGGAAGACTGCCATTACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1333-Ab Anti-TFF2/ SML1/ SP functional antibody
    Target Antigen GM-Tg-g-SE1333-Ag TFF2 protein
    ORF Viral Vector pGMLP002301 Human TFF2 Lentivirus plasmid
    ORF Viral Vector vGMLP002301 Human TFF2 Lentivirus particle


    Target information

    Target ID GM-SE1333
    Target Name TFF2
    Gene ID 7032, 21785, 714550, 116592, 100170653, 403489, 616105, 100051351
    Gene Symbol and Synonyms mSP,SML1,SP,TFF2
    Uniprot Accession Q03403
    Uniprot Entry Name TFF2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker
    Disease Cancer
    Gene Ensembl ENSG00000160181
    Target Classification Tumor-associated antigen (TAA)

    Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.