Human TFF2/SML1/ SP ORF/cDNA clone-Lentivirus particle (NM_005423)
Pre-made Human TFF2/SML1/ SP Lentiviral expression plasmid for TFF2 lentivirus packaging, TFF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TFF2/SML1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002301 | Human TFF2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002301 |
Gene Name | TFF2 |
Accession Number | NM_005423 |
Gene ID | 7032 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 390 bp |
Gene Alias | SML1, SP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGACGGCGAGACGCCCAGCTCCTGGCAGCGCTCCTCGTCCTGGGGCTATGTGCCCTGGCGGGGAGTGAGAAACCCTCCCCCTGCCAGTGCTCCAGGCTGAGCCCCCATAACAGGACGAACTGCGGCTTCCCTGGAATCACCAGTGACCAGTGTTTTGACAATGGATGCTGTTTCGACTCCAGTGTCACTGGGGTCCCCTGGTGTTTCCACCCCCTCCCAAAGCAAGAGTCGGATCAGTGCGTCATGGAGGTCTCAGACCGAAGAAACTGTGGCTACCCGGGCATCAGCCCCGAGGAATGCGCCTCTCGGAAGTGCTGCTTCTCCAACTTCATCTTTGAAGTGCCCTGGTGCTTCTTCCCGAAGTCTGTGGAAGACTGCCATTACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1333-Ab | Anti-TFF2/ SML1/ SP functional antibody |
Target Antigen | GM-Tg-g-SE1333-Ag | TFF2 protein |
ORF Viral Vector | pGMLP002301 | Human TFF2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002301 | Human TFF2 Lentivirus particle |
Target information
Target ID | GM-SE1333 |
Target Name | TFF2 |
Gene ID | 7032, 21785, 714550, 116592, 100170653, 403489, 616105, 100051351 |
Gene Symbol and Synonyms | mSP,SML1,SP,TFF2 |
Uniprot Accession | Q03403 |
Uniprot Entry Name | TFF2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker |
Disease | Cancer |
Gene Ensembl | ENSG00000160181 |
Target Classification | Tumor-associated antigen (TAA) |
Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.