Human CD58/ag3/ LFA-3 ORF/cDNA clone-Lentivirus particle (NM_001779)

Pre-made Human CD58/ag3/ LFA-3 Lentiviral expression plasmid for CD58 lentivirus packaging, CD58 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CD58/ag3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002315 Human CD58 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002315
Gene Name CD58
Accession Number NM_001779
Gene ID 965
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 753 bp
Gene Alias ag3, LFA-3, LFA3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTTGCTGGGAGCGACGCGGGGCGGGCCCTGGGGGTCCTCAGCGTGGTCTGCCTGCTGCACTGCTTTGGTTTCATCAGCTGTTTTTCCCAACAAATATATGGTGTTGTGTATGGGAATGTAACTTTCCATGTACCAAGCAATGTGCCTTTAAAAGAGGTCCTATGGAAAAAACAAAAGGATAAAGTTGCAGAACTGGAAAATTCTGAATTCAGAGCTTTCTCATCTTTTAAAAATAGGGTTTATTTAGACACTGTGTCAGGTAGCCTCACTATCTACAACTTAACATCATCAGATGAAGATGAGTATGAAATGGAATCGCCAAATATTACTGATACCATGAAGTTCTTTCTTTATGTGCTTGAGTCTCTTCCATCTCCCACACTAACTTGTGCATTGACTAATGGAAGCATTGAAGTCCAATGCATGATACCAGAGCATTACAACAGCCATCGAGGACTTATAATGTACTCATGGGATTGTCCTATGGAGCAATGTAAACGTAACTCAACCAGTATATATTTTAAGATGGAAAATGATCTTCCACAAAAAATACAGTGTACTCTTAGCAATCCATTATTTAATACAACATCATCAATCATTTTGACAACCTGTATCCCAAGCAGCGGTCATTCAAGACACAGATATGCACTTATACCCATACCATTAGCAGTAATTACAACATGTATTGTGCTGTATATGAATGGTATTCTGAAATGTGACAGAAAACCAGACAGAACCAACTCCAATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59122-Ab Anti-LFA3/ CD58/ LFA-3 monoclonal antibody
    Target Antigen GM-Tg-g-T59122-Ag CD58 VLP (virus-like particle)
    ORF Viral Vector pGMLP002315 Human CD58 Lentivirus plasmid
    ORF Viral Vector vGMLP002315 Human CD58 Lentivirus particle


    Target information

    Target ID GM-T59122
    Target Name CD58
    Gene ID 965, 710732, 101085141, 102156962, 782186, 100066062
    Gene Symbol and Synonyms ag3,CD58,LFA-3,LFA3
    Uniprot Accession P19256
    Uniprot Entry Name LFA3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000116815
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a ligand of the T lymphocyte CD2 protein, and functions in adhesion and activation of T lymphocytes. The protein is localized to the plasma membrane. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.