Human ARPC1A/Arc40/HEL-68 ORF/cDNA clone-Lentivirus particle (NM_006409)

Cat. No.: vGMLP002491

Pre-made Human ARPC1A/Arc40/HEL-68 Lentiviral expression plasmid for ARPC1A lentivirus packaging, ARPC1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ARPC1A/Arc40 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002491 Human ARPC1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002491
Gene Name ARPC1A
Accession Number NM_006409
Gene ID 10552
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1113 bp
Gene Alias Arc40,HEL-68,HEL-S-307,SOP2Hs,SOP2L
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCACTGCATCAGTTTTTACTAGAGCCAATCACCTGTCATGCCTGGAACAGGGATCGTACTCAGATTGCCCTCAGTCCCAATAATCACGAAGTGCACATCTATAAGAAGAACGGGAGCCAGTGGGTGAAAGCTCATGAACTCAAGGAGCACAACGGACACATCACAGGTATTGACTGGGCTCCCAAGAGCGACCGCATTGTCACTTGTGGGGCAGACCGCAATGCCTATGTCTGGAGTCAGAAAGATGGTGTTTGGAAGCCAACCCTGGTGATCCTGAGAATTAATCGCGCAGCTACTTTTGTGAAGTGGTCCCCCCTAGAGAACAAATTTGCTGTGGGAAGTGGAGCACGACTCATTTCTGTTTGTTACTTTGAGTCTGAAAATGACTGGTGGGTGAGCAAGCACATTAAAAAGCCGATTCGCTCCACAGTCCTCAGCTTGGATTGGCATCCCAACAACGTTTTGCTGGCAGCAGGATCATGTGACTTCAAATGCAGAGTGTTTTCTGCCTACATTAAAGAAGTGGATGAAAAGCCAGCCAGCACGCCCTGGGGCAGCAAGATGCCTTTTGGGCAGCTGATGTCAGAGTTTGGTGGCAGTGGCACTGGTGGCTGGGTCCACGGGGTAAGCTTCTCTGCCAGTGGGAGCCGCCTGGCCTGGGTCAGCCACGACAGCACCGTGTCTGTTGCTGATGCCTCAAAAAGTGTGCAGGTCTCGACTCTGAAGACAGAGTTCCTGCCGCTCCTAAGTGTGTCATTTGTCTCAGAGAACAGCGTCGTGGCTGCTGGCCATGACTGCTGCCCAATGCTCTTTAACTACGATGACCGCGGCTGCCTGACCTTCGTCTCCAAGTTAGATATTCCAAAACAGAGCATCCAACGCAACATGTCTGCCATGGAACGCTTCCGCAACATGGACAAGAGAGCCACAACTGAGGACCGCAACACGGCCTTGGAGACGCTGCACCAGAATAGCATCACTCAAGTCTCTATTTATGAGGTGGACAAGCAAGATTGTCGCAAATTTTGCACTACTGGCATCGATGGAGCCATGACAATTTGGGATTTCAAGACCCTCGAGTCTTCCATCCAGGGCCTCCGGATAATGTGA
ORF Protein Sequence MSLHQFLLEPITCHAWNRDRTQIALSPNNHEVHIYKKNGSQWVKAHELKEHNGHITGIDWAPKSDRIVTCGADRNAYVWSQKDGVWKPTLVILRINRAATFVKWSPLENKFAVGSGARLISVCYFESENDWWVSKHIKKPIRSTVLSLDWHPNNVLLAAGSCDFKCRVFSAYIKEVDEKPASTPWGSKMPFGQLMSEFGGSGTGGWVHGVSFSASGSRLAWVSHDSTVSVADASKSVQVSTLKTEFLPLLSVSFVSENSVVAAGHDCCPMLFNYDDRGCLTFVSKLDIPKQSIQRNMSAMERFRNMDKRATTEDRNTALETLHQNSITQVSIYEVDKQDCRKFCTTGIDGAMTIWDFKTLESSIQGLRIM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2360-Ab Anti-ARPC1A monoclonal antibody
    Target Antigen GM-Tg-g-IP2360-Ag ARPC1A protein
    ORF Viral Vector pGMLP002491 Human ARPC1A Lentivirus plasmid
    ORF Viral Vector vGMLP002491 Human ARPC1A Lentivirus particle


    Target information

    Target ID GM-IP2360
    Target Name ARPC1A
    Gene ID 10552, 56443, 718635, 81824, 101084410, 479745, 508402, 100059256
    Gene Symbol and Synonyms 0610010H08Rik,1110030K07Rik,41kDa,Arc40,ARPC1A,HEL-68,HEL-S-307,Sid32,Sid329,SOP2Hs,SOP2L
    Uniprot Accession Q92747
    Uniprot Entry Name ARC1A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000241685
    Target Classification Not Available

    This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.