Human SGK1/SGK ORF/cDNA clone-Lentivirus particle (NM_005627)

Pre-made Human SGK1/SGK Lentiviral expression plasmid for SGK1 lentivirus packaging, SGK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SGK1/SGK products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002697 Human SGK1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002697
Gene Name SGK1
Accession Number NM_005627
Gene ID 6446
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1296 bp
Gene Alias SGK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACGGTGAAAACTGAGGCTGCTAAGGGCACCCTCACTTACTCCAGGATGAGGGGCATGGTGGCAATTCTCATCGCTTTCATGAAGCAGAGGAGGATGGGTCTGAACGACTTTATTCAGAAGATTGCCAATAACTCCTATGCATGCAAACACCCTGAAGTTCAGTCCATCTTGAAGATCTCCCAACCTCAGGAGCCTGAGCTTATGAATGCCAACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTGCCTTGGGCTACCTGCATTCACTGAACATCGTTTATAGAGACTTAAAACCAGAGAATATTTTGCTAGATTCACAGGGACACATTGTCCTTACTGACTTCGGACTCTGCAAGGAGAACATTGAACACAACAGCACAACATCCACCTTCTGTGGCACGCCGGAGTATCTCGCACCTGAGGTGCTTCATAAGCAGCCTTATGACAGGACTGTGGACTGGTGGTGCCTGGGAGCTGTCTTGTATGAGATGCTGTATGGCCTGCCGCCTTTTTATAGCCGAAACACAGCTGAAATGTACGACAACATTCTGAACAAGCCTCTCCAGCTGAAACCAAATATTACAAATTCCGCAAGACACCTCCTGGAGGGCCTCCTGCAGAAGGACAGGACAAAGCGGCTCGGGGCCAAGGATGACTTCATGGAGATTAAGAGTCATGTCTTCTTCTCCTTAATTAACTGGGATGATCTCATTAATAAGAAGATTACTCCCCCTTTTAACCCAAATGTGAGTGGGCCCAACGACCTACGGCACTTTGACCCCGAGTTTACCGAAGAGCCTGTCCCCAACTCCATTGGCAAGTCCCCTGACAGCGTCCTCGTCACAGCCAGCGTCAAGGAAGCTGCCGAGGCTTTCCTAGGCTTTTCCTATGCGCCTCCCACGGACTCTTTCCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T64682-Ab Anti-SGK1 monoclonal antibody
    Target Antigen GM-Tg-g-T64682-Ag SGK1 protein
    ORF Viral Vector pGMLP002697 Human SGK1 Lentivirus plasmid
    ORF Viral Vector vGMLP002697 Human SGK1 Lentivirus particle


    Target information

    Target ID GM-T64682
    Target Name SGK1
    Gene ID 6446, 20393, 713082, 29517, 101098954, 403647, 515854, 100073151
    Gene Symbol and Synonyms SGK,SGK1
    Uniprot Accession O00141
    Uniprot Entry Name SGK1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000118515
    Target Classification Kinase, Tumor-associated antigen (TAA)

    This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. High levels of expression of this gene may contribute to conditions such as hypertension and diabetic nephropathy. Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.