Human SGK1/SGK ORF/cDNA clone-Lentivirus particle (NM_005627)
Pre-made Human SGK1/SGK Lentiviral expression plasmid for SGK1 lentivirus packaging, SGK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SGK1/SGK products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002697 | Human SGK1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002697 |
Gene Name | SGK1 |
Accession Number | NM_005627 |
Gene ID | 6446 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1296 bp |
Gene Alias | SGK |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACGGTGAAAACTGAGGCTGCTAAGGGCACCCTCACTTACTCCAGGATGAGGGGCATGGTGGCAATTCTCATCGCTTTCATGAAGCAGAGGAGGATGGGTCTGAACGACTTTATTCAGAAGATTGCCAATAACTCCTATGCATGCAAACACCCTGAAGTTCAGTCCATCTTGAAGATCTCCCAACCTCAGGAGCCTGAGCTTATGAATGCCAACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTGCCTTGGGCTACCTGCATTCACTGAACATCGTTTATAGAGACTTAAAACCAGAGAATATTTTGCTAGATTCACAGGGACACATTGTCCTTACTGACTTCGGACTCTGCAAGGAGAACATTGAACACAACAGCACAACATCCACCTTCTGTGGCACGCCGGAGTATCTCGCACCTGAGGTGCTTCATAAGCAGCCTTATGACAGGACTGTGGACTGGTGGTGCCTGGGAGCTGTCTTGTATGAGATGCTGTATGGCCTGCCGCCTTTTTATAGCCGAAACACAGCTGAAATGTACGACAACATTCTGAACAAGCCTCTCCAGCTGAAACCAAATATTACAAATTCCGCAAGACACCTCCTGGAGGGCCTCCTGCAGAAGGACAGGACAAAGCGGCTCGGGGCCAAGGATGACTTCATGGAGATTAAGAGTCATGTCTTCTTCTCCTTAATTAACTGGGATGATCTCATTAATAAGAAGATTACTCCCCCTTTTAACCCAAATGTGAGTGGGCCCAACGACCTACGGCACTTTGACCCCGAGTTTACCGAAGAGCCTGTCCCCAACTCCATTGGCAAGTCCCCTGACAGCGTCCTCGTCACAGCCAGCGTCAAGGAAGCTGCCGAGGCTTTCCTAGGCTTTTCCTATGCGCCTCCCACGGACTCTTTCCTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T64682-Ab | Anti-SGK1 monoclonal antibody |
Target Antigen | GM-Tg-g-T64682-Ag | SGK1 protein |
ORF Viral Vector | pGMLP002697 | Human SGK1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002697 | Human SGK1 Lentivirus particle |
Target information
Target ID | GM-T64682 |
Target Name | SGK1 |
Gene ID | 6446, 20393, 713082, 29517, 101098954, 403647, 515854, 100073151 |
Gene Symbol and Synonyms | SGK,SGK1 |
Uniprot Accession | O00141 |
Uniprot Entry Name | SGK1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000118515 |
Target Classification | Kinase, Tumor-associated antigen (TAA) |
This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. High levels of expression of this gene may contribute to conditions such as hypertension and diabetic nephropathy. Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.