Human BMP4/BMP2B/ BMP2B1 ORF/cDNA clone-Lentivirus particle (NM_130850)
Pre-made Human BMP4/BMP2B/ BMP2B1 Lentiviral expression plasmid for BMP4 lentivirus packaging, BMP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BMP4/BMP2B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002725 | Human BMP4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002725 |
Gene Name | BMP4 |
Accession Number | NM_130850 |
Gene ID | 652 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1227 bp |
Gene Alias | BMP2B, BMP2B1, MCOPS6, OFC11, ZYME |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGCGCGAGCCATGCTAGTTTGATACCTGAGACGGGGAAGAAAAAAGTCGCCGAGATTCAGGGCCACGCGGGAGGACGCCGCTCAGGGCAGAGCCATGAGCTCCTGCGGGACTTCGAGGCGACACTTCTGCAGATGTTTGGGCTGCGCCGCCGCCCGCAGCCTAGCAAGAGTGCCGTCATTCCGGACTACATGCGGGATCTTTACCGGCTTCAGTCTGGGGAGGAGGAGGAAGAGCAGATCCACAGCACTGGTCTTGAGTATCCTGAGCGCCCGGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCACGAAGAACATCTGGAGAACATCCCAGGGACCAGTGAAAACTCTGCTTTTCGTTTCCTCTTTAACCTCAGCAGCATCCCTGAGAACGAGGTGATCTCCTCTGCAGAGCTTCGGCTCTTCCGGGAGCAGGTGGACCAGGGCCCTGATTGGGAAAGGGGCTTCCACCGTATAAACATTTATGAGGTTATGAAGCCCCCAGCAGAAGTGGTGCCTGGGCACCTCATCACACGACTACTGGACACGAGACTGGTCCACCACAATGTGACACGGTGGGAAACTTTTGATGTGAGCCCTGCGGTCCTTCGCTGGACCCGGGAGAAGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACCTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAGGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGGGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGGCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACTGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGGTCAATTCTGTCAATTCCAGTATCCCCAAAGCCTGTTGTGTGCCCACTGAACTGAGTGCCATCTCCATGCTGTACCTGGATGAGTATGATAAGGTGGTACTGAAAAATTATCAGGAGATGGTAGTAGAGGGATGTGGGTGCCGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T77410-Ab | Anti-BMP4/ BMP2B/ BMP2B1 functional antibody |
Target Antigen | GM-Tg-g-T77410-Ag | BMP4 protein |
Cytokine | cks-Tg-g-GM-T77410 | bone morphogenetic protein 4 (BMP4) protein & antibody |
ORF Viral Vector | pGMPC000918 | Human BMP4 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP002725 | Human BMP4 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-069 | Human BMP4 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-209 | Human BMP4 Adenovirus plasmid |
ORF Viral Vector | vGMLP002725 | Human BMP4 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-069 | Human BMP4 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-209 | Human BMP4 Adenovirus particle |
ORF Viral Vector | pGMLV002331 | Mouse Bmp4 Lentivirus plasmid |
Target information
Target ID | GM-T77410 |
Target Name | BMP4 |
Gene ID | 652, 12159, 694618, 25296, 101100311, 490695, 407216, 100034048 |
Gene Symbol and Synonyms | Bmp-4,BMP2B,Bmp2b-1,BMP2B1,BMP4,BOMPR4A,MCOPS6,OFC11,ZYME |
Uniprot Accession | P12644 |
Uniprot Entry Name | BMP4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000125378 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.