Human BMP4/BMP2B/ BMP2B1 ORF/cDNA clone-Lentivirus particle (NM_130850)

Pre-made Human BMP4/BMP2B/ BMP2B1 Lentiviral expression plasmid for BMP4 lentivirus packaging, BMP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to BMP4/BMP2B products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002725 Human BMP4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002725
Gene Name BMP4
Accession Number NM_130850
Gene ID 652
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1227 bp
Gene Alias BMP2B, BMP2B1, MCOPS6, OFC11, ZYME
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGCGCGAGCCATGCTAGTTTGATACCTGAGACGGGGAAGAAAAAAGTCGCCGAGATTCAGGGCCACGCGGGAGGACGCCGCTCAGGGCAGAGCCATGAGCTCCTGCGGGACTTCGAGGCGACACTTCTGCAGATGTTTGGGCTGCGCCGCCGCCCGCAGCCTAGCAAGAGTGCCGTCATTCCGGACTACATGCGGGATCTTTACCGGCTTCAGTCTGGGGAGGAGGAGGAAGAGCAGATCCACAGCACTGGTCTTGAGTATCCTGAGCGCCCGGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCACGAAGAACATCTGGAGAACATCCCAGGGACCAGTGAAAACTCTGCTTTTCGTTTCCTCTTTAACCTCAGCAGCATCCCTGAGAACGAGGTGATCTCCTCTGCAGAGCTTCGGCTCTTCCGGGAGCAGGTGGACCAGGGCCCTGATTGGGAAAGGGGCTTCCACCGTATAAACATTTATGAGGTTATGAAGCCCCCAGCAGAAGTGGTGCCTGGGCACCTCATCACACGACTACTGGACACGAGACTGGTCCACCACAATGTGACACGGTGGGAAACTTTTGATGTGAGCCCTGCGGTCCTTCGCTGGACCCGGGAGAAGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACCTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAGGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGGGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGGCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACTGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGGTCAATTCTGTCAATTCCAGTATCCCCAAAGCCTGTTGTGTGCCCACTGAACTGAGTGCCATCTCCATGCTGTACCTGGATGAGTATGATAAGGTGGTACTGAAAAATTATCAGGAGATGGTAGTAGAGGGATGTGGGTGCCGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77410-Ab Anti-BMP4/ BMP2B/ BMP2B1 functional antibody
    Target Antigen GM-Tg-g-T77410-Ag BMP4 protein
    Cytokine cks-Tg-g-GM-T77410 bone morphogenetic protein 4 (BMP4) protein & antibody
    ORF Viral Vector pGMPC000918 Human BMP4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002725 Human BMP4 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-069 Human BMP4 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-209 Human BMP4 Adenovirus plasmid
    ORF Viral Vector vGMLP002725 Human BMP4 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-069 Human BMP4 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-209 Human BMP4 Adenovirus particle
    ORF Viral Vector pGMLV002331 Mouse Bmp4 Lentivirus plasmid


    Target information

    Target ID GM-T77410
    Target Name BMP4
    Gene ID 652, 12159, 694618, 25296, 101100311, 490695, 407216, 100034048
    Gene Symbol and Synonyms Bmp-4,BMP2B,Bmp2b-1,BMP2B1,BMP4,BOMPR4A,MCOPS6,OFC11,ZYME
    Uniprot Accession P12644
    Uniprot Entry Name BMP4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000125378
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.