Human SPINK1/PCTT/ PSTI ORF/cDNA clone-Lentivirus particle (NM_003122)

Pre-made Human SPINK1/PCTT/ PSTI Lentiviral expression plasmid for SPINK1 lentivirus packaging, SPINK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SPINK1/PCTT products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002897 Human SPINK1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002897
Gene Name SPINK1
Accession Number NM_003122
Gene ID 6690
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 240 bp
Gene Alias PCTT, PSTI, Spink3, TATI, TCP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGTAACAGGCATCTTTCTTCTCAGTGCCTTGGCCCTGTTGAGTCTATCTGGTAACACTGGAGCTGACTCCCTGGGAAGAGAGGCCAAATGTTACAATGAACTTAATGGATGCACCAAGATATATGACCCTGTCTGTGGGACTGATGGAAATACTTATCCCAATGAATGCGTGTTATGTTTTGAAAATCGGAAACGCCAGACTTCTATCCTCATTCAAAAATCTGGGCCTTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1309-Ab Anti-ISK1/ SPINK1/ PCTT functional antibody
    Target Antigen GM-Tg-g-SE1309-Ag SPINK1 protein
    ORF Viral Vector pGMLP002897 Human SPINK1 Lentivirus plasmid
    ORF Viral Vector vGMLP002897 Human SPINK1 Lentivirus particle


    Target information

    Target ID GM-SE1309
    Target Name SPINK1
    Gene ID 6690, 20730, 708951, 101085948, 608433, 574092, 100630883
    Gene Symbol and Synonyms p12,PCTT,PSTI,SPINK1,Spink3,TATI,TCP
    Uniprot Accession P00995
    Uniprot Entry Name ISK1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000164266
    Target Classification Not Available

    The protein encoded by this gene is a trypsin inhibitor, which is secreted from pancreatic acinar cells into pancreatic juice. It is thought to function in the prevention of trypsin-catalyzed premature activation of zymogens within the pancreas and the pancreatic duct. Mutations in this gene are associated with hereditary pancreatitis and tropical calcific pancreatitis. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.