Human SPINT2/DIAR3/HAI-2 ORF/cDNA clone-Lentivirus particle (NM_021102)

Cat. No.: vGMLP002899

Pre-made Human SPINT2/DIAR3/HAI-2 Lentiviral expression plasmid for SPINT2 lentivirus packaging, SPINT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SPINT2/DIAR3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002899 Human SPINT2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002899
Gene Name SPINT2
Accession Number NM_021102
Gene ID 10653
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 759 bp
Gene Alias DIAR3,HAI-2,HAI2,Kop,PB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCAGCTGTGCGGGCTGAGGCGGAGCCGGGCGTTTCTCGCCCTGCTGGGATCGCTGCTCCTCTCTGGGGTCCTGGCGGCCGACCGAGAACGCAGCATCCACGACTTCTGCCTGGTGTCGAAGGTGGTGGGCAGATGCCGGGCCTCCATGCCTAGGTGGTGGTACAATGTCACTGACGGATCCTGCCAGCTGTTTGTGTATGGGGGCTGTGACGGAAACAGCAATAATTACCTGACCAAGGAGGAGTGCCTCAAGAAATGTGCCACTGTCACAGAGAATGCCACGGGTGACCTGGCCACCAGCAGGAATGCAGCGGATTCCTCTGTCCCAAGTGCTCCCAGAAGGCAGGATTCTGAAGACCACTCCAGCGATATGTTCAACTATGAAGAATACTGCACCGCCAACGCAGTCACTGGGCCTTGCCGTGCATCCTTCCCACGCTGGTACTTTGACGTGGAGAGGAACTCCTGCAATAACTTCATCTATGGAGGCTGCCGGGGCAATAAGAACAGCTACCGCTCTGAGGAGGCCTGCATGCTCCGCTGCTTCCGCCAGCAGGAGAATCCTCCCCTGCCCCTTGGCTCAAAGGTGGTGGTTCTGGCGGGGCTGTTCGTGATGGTGTTGATCCTCTTCCTGGGAGCCTCCATGGTCTACCTGATCCGGGTGGCACGGAGGAACCAGGAGCGTGCCCTGCGCACCGTCTGGAGCTCCGGAGATGACAAGGAGCAGCTGGTGAAGAACACATATGTCCTGTGA
ORF Protein Sequence MAQLCGLRRSRAFLALLGSLLLSGVLAADRERSIHDFCLVSKVVGRCRASMPRWWYNVTDGSCQLFVYGGCDGNSNNYLTKEECLKKCATVTENATGDLATSRNAADSSVPSAPRRQDSEDHSSDMFNYEEYCTANAVTGPCRASFPRWYFDVERNSCNNFIYGGCRGNKNSYRSEEACMLRCFRQQENPPLPLGSKVVVLAGLFVMVLILFLGASMVYLIRVARRNQERALRTVWSSGDDKEQLVKNTYVL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1700-Ab Anti-SPIT2/ SPINT2/ DIAR3 monoclonal antibody
    Target Antigen GM-Tg-g-MP1700-Ag SPINT2 VLP (virus-like particle)
    ORF Viral Vector pGMLP002899 Human SPINT2 Lentivirus plasmid
    ORF Viral Vector vGMLP002899 Human SPINT2 Lentivirus particle


    Target information

    Target ID GM-MP1700
    Target Name SPINT2
    Gene ID 10653, 20733, 714755, 292770, 101101682, 403665, 507484, 100064080
    Gene Symbol and Synonyms BIKUNIN,DIAR3,HAI-2,HAI2,Kop,PB,SPINT2
    Uniprot Accession O43291
    Uniprot Entry Name SPIT2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Ovary Cancer
    Gene Ensembl ENSG00000167642
    Target Classification Not Available

    This gene encodes a transmembrane protein with two extracellular Kunitz domains that inhibits a variety of serine proteases. The protein inhibits HGF activator which prevents the formation of active hepatocyte growth factor. This gene is a putative tumor suppressor, and mutations in this gene result in congenital sodium diarrhea. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.