Human HBA1/HBA-T3/ HBH ORF/cDNA clone-Lentivirus particle (NM_000558)
Pre-made Human HBA1/HBA-T3/ HBH Lentiviral expression plasmid for HBA1 lentivirus packaging, HBA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to HB/HBA1/HBA-T3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002912 | Human HBA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002912 |
Gene Name | HBA1 |
Accession Number | NM_000558 |
Gene ID | 3039 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 429 bp |
Gene Alias | HBA-T3, HBH |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T49493-Ab | Anti-HB monoclonal antibody |
Target Antigen | GM-Tg-g-T49493-Ag | HB/HBA2 protein |
ORF Viral Vector | pGMLP000959 | Human HBA2 Lentivirus plasmid |
ORF Viral Vector | pGMLP002912 | Human HBA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000959 | Human HBA2 Lentivirus particle |
ORF Viral Vector | vGMLP002912 | Human HBA1 Lentivirus particle |
Target information
Target ID | GM-T49493 |
Target Name | HB |
Gene ID | 3040 |
Gene Symbol and Synonyms | ECYT7,HBA-T2,HBA2,HBH |
Uniprot Accession | P69905 |
Uniprot Entry Name | HBA_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Alzheimer's Disease, congestive heart failure, Diabetes type-2 |
Gene Ensembl | ENSG00000188536 |
Target Classification | Not Available |
The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.