Human OPN1LW/CBBM/CBP ORF/cDNA clone-Lentivirus particle (NM_020061)

Cat. No.: vGMLP002980

Pre-made Human OPN1LW/CBBM/CBP Lentiviral expression plasmid for OPN1LW lentivirus packaging, OPN1LW lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to OPN1LW/CBBM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002980 Human OPN1LW Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002980
Gene Name OPN1LW
Accession Number NM_020061
Gene ID 5956
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1095 bp
Gene Alias CBBM,CBP,COD5,RCP,ROP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTTGTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACCATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCTGACCTAGCAGAGACCGTCATCGCCAGCACTATCAGCATTGTGAACCAGGTCTCTGGCTACTTCGTGCTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGTCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCTGCAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATCTGGGCTGCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGCTATCATCATGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCTGCTGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGTTACGCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTACTTTGCCAAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCCTCGGTATCGCCTGCATGA
ORF Protein Sequence MAQQWSLQRLAGRHPQDSYEDSTQSSIFTYTNSNSTRGPFEGPNYHIAPRWVYHLTSVWMIFVVTASVFTNGLVLAATMKFKKLRHPLNWILVNLAVADLAETVIASTISIVNQVSGYFVLGHPMCVLEGYTVSLCGITGLWSLAIISWERWMVVCKPFGNVRFDAKLAIVGIAFSWIWAAVWTAPPIFGWSRYWPHGLKTSCGPDVFSGSSYPGVQSYMIVLMVTCCIIPLAIIMLCYLQVWLAIRAVAKQQKESESTQKAEKEVTRMVVVMIFAYCVCWGPYTFFACFAAANPGYAFHPLMAALPAYFAKSATIYNPVIYVFMNRQFRNCILQLFGKKVDDGSELSSASKTEVSSVSSVSPA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1304-Ab Anti-OPN1LW monoclonal antibody
    Target Antigen GM-Tg-g-IP1304-Ag OPN1LW protein
    ORF Viral Vector pGMLP002980 Human OPN1LW Lentivirus plasmid
    ORF Viral Vector vGMLP002980 Human OPN1LW Lentivirus particle


    Target information

    Target ID GM-IP1304
    Target Name OPN1LW
    Gene ID 5956, 699016, 282293
    Gene Symbol and Synonyms CBBM,CBP,COD5,OPN1LW,OPSN,RCP,ROP
    Uniprot Accession P04000
    Uniprot Entry Name OPSR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102076
    Target Classification Not Available

    This gene encodes for a light absorbing visual pigment of the opsin gene family. The encoded protein is called red cone photopigment or long-wavelength sensitive opsin. Opsins are G-protein coupled receptors with seven transmembrane domains, an N-terminal extracellular domain, and a C-terminal cytoplasmic domain. This gene and the medium-wavelength opsin gene are tandemly arrayed on the X chromosome and frequent unequal recombination and gene conversion may occur between these sequences. X chromosomes may have fusions of the medium- and long-wavelength opsin genes or may have more than one copy of these genes. Defects in this gene are the cause of partial, protanopic colorblindness. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.