Human ACKR3/CMKOR1/ CXC-R7 ORF/cDNA clone-Lentivirus particle (NM_020311)
Pre-made Human ACKR3/CMKOR1/ CXC-R7 Lentiviral expression plasmid for ACKR3 lentivirus packaging, ACKR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ACKR3/CMKOR1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003139 | Human ACKR3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003139 |
Gene Name | ACKR3 |
Accession Number | NM_020311 |
Gene ID | 57007 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1089 bp |
Gene Alias | CMKOR1, CXC-R7, CXCR-7, CXCR7, GPR159, RDC-1, RDC1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGATCTGCATCTCTTCGACTACTCAGAGCCAGGGAACTTCTCGGACATCAGCTGGCCATGCAACAGCAGCGACTGCATCGTGGTGGACACGGTGATGTGTCCCAACATGCCCAACAAAAGCGTCCTGCTCTACACGCTCTCCTTCATTTACATTTTCATCTTCGTCATCGGCATGATTGCCAACTCCGTGGTGGTCTGGGTGAATATCCAGGCCAAGACCACAGGCTATGACACGCACTGCTACATCTTGAACCTGGCCATTGCCGACCTGTGGGTTGTCCTCACCATCCCAGTCTGGGTGGTCAGTCTCGTGCAGCACAACCAGTGGCCCATGGGCGAGCTCACGTGCAAAGTCACACACCTCATCTTCTCCATCAACCTCTTCGGCAGCATTTTCTTCCTCACGTGCATGAGCGTGGACCGCTACCTCTCCATCACCTACTTCACCAACACCCCCAGCAGCAGGAAGAAGATGGTACGCCGTGTCGTCTGCATCCTGGTGTGGCTGCTGGCCTTCTGCGTGTCTCTGCCTGACACCTACTACCTGAAGACCGTCACGTCTGCGTCCAACAATGAGACCTACTGCCGGTCCTTCTACCCCGAGCACAGCATCAAGGAGTGGCTGATCGGCATGGAGCTGGTCTCCGTTGTCTTGGGCTTTGCCGTTCCCTTCTCCATTATCGCTGTCTTCTACTTCCTGCTGGCCAGAGCCATCTCGGCGTCCAGTGACCAGGAGAAGCACAGCAGCCGGAAGATCATCTTCTCCTACGTGGTGGTCTTCCTTGTCTGCTGGCTGCCCTACCACGTGGCGGTGCTGCTGGACATCTTCTCCATCCTGCACTACATCCCTTTCACCTGCCGGCTGGAGCACGCCCTCTTCACGGCCCTGCATGTCACACAGTGCCTGTCGCTGGTGCACTGCTGCGTCAACCCTGTCCTCTACAGCTTCATCAATCGCAACTACAGGTACGAGCTGATGAAGGCCTTCATCTTCAAGTACTCGGCCAAAACAGGGCTCACCAAGCTCATCGATGCCTCCAGAGTCTCAGAGACGGAGTACTCTGCCTTGGAGCAGAGCACCAAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T10491-Ab | Anti-ACKR3/ CMKOR1/ CXC-R7 monoclonal antibody |
Target Antigen | GM-Tg-g-T10491-Ag | ACKR3 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T10491 | chemokine (C-X-C motif) receptor 7 (CXCR7) protein & antibody |
ORF Viral Vector | pGMLV000082 | Human ACKR3 Lentivirus plasmid |
ORF Viral Vector | pGMLV000566 | Human ACKR3 Lentivirus plasmid |
ORF Viral Vector | pGMLP003139 | Human ACKR3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000125 | Human ACKR3 Adenovirus plasmid |
ORF Viral Vector | pGMAP000127 | Human ACKR3 Adenovirus plasmid |
ORF Viral Vector | vGMLV000082 | Human ACKR3 Lentivirus particle |
ORF Viral Vector | vGMLV000566 | Human ACKR3 Lentivirus particle |
ORF Viral Vector | vGMLP003139 | Human ACKR3 Lentivirus particle |
ORF Viral Vector | vGMAP000125 | Human ACKR3 Adenovirus particle |
ORF Viral Vector | vGMAP000127 | Human ACKR3 Adenovirus particle |
ORF Viral Vector | pGMLV002260 | Mouse Ackr3 Lentivirus plasmid |
Target information
Target ID | GM-T10491 |
Target Name | ACKR3 |
Gene ID | 57007, 12778, 694428, 84348, 101080817, 403964, 509585, 100057501 |
Gene Symbol and Synonyms | ACKR3,CMKOR1,CXC-R7,CXCR-7,CXCR7,GPR159,RDC-1,RDC1 |
Uniprot Accession | P25106 |
Uniprot Entry Name | ACKR3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000144476 |
Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
This gene encodes a member of the G-protein coupled receptor family. Although this protein was earlier thought to be a receptor for vasoactive intestinal peptide (VIP), it is now considered to be an orphan receptor, in that its endogenous ligand has not been identified. The protein is also a coreceptor for human immunodeficiency viruses (HIV). Translocations involving this gene and HMGA2 on chromosome 12 have been observed in lipomas. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.