Human H3-3B/H3.3B ORF/cDNA clone-Lentivirus particle (NM_005324)
Pre-made Human H3-3B/H3.3B Lentiviral expression plasmid for H3-3B lentivirus packaging, H3-3B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to H3F3A/H3-3B/H3.3B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003167 | Human H3-3B Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003167 |
Gene Name | H3-3B |
Accession Number | NM_005324 |
Gene ID | 3021 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 411 bp |
Gene Alias | H3.3B |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCGAACCAAGCAGACTGCTCGTAAGTCCACCGGTGGGAAAGCCCCCCGCAAACAGCTGGCCACGAAAGCCGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAGAAGCCTCATCGCTACAGGCCCGGGACCGTGGCGCTTCGAGAGATTCGTCGTTATCAGAAGTCGACCGAGCTGCTCATCCGGAAGCTGCCCTTCCAGAGGTTGGTGAGGGAGATCGCGCAGGATTTCAAAACCGACCTGAGGTTTCAGAGCGCAGCCATCGGTGCGCTGCAGGAGGCTAGCGAAGCGTACCTGGTGGGTCTGTTCGAAGATACCAACCTGTGTGCCATCCACGCTAAGAGAGTCACCATCATGCCCAAAGACATCCAGTTGGCTCGCCGGATACGGGGAGAGAGAGCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T90766-Ab | Anti-H3F3A monoclonal antibody |
Target Antigen | GM-Tg-g-T90766-Ag | H3F3A protein |
ORF Viral Vector | pGMAAV000030 | Human H3-3B Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP003167 | Human H3-3B Lentivirus plasmid |
ORF Viral Vector | pGMLP004571 | Human H3-3A Lentivirus plasmid |
ORF Viral Vector | vGMAAV000030 | Human H3-3B Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP003167 | Human H3-3B Lentivirus particle |
ORF Viral Vector | vGMLP004571 | Human H3-3A Lentivirus particle |
Target information
Target ID | GM-T90766 |
Target Name | H3F3A |
Gene ID | 3020, 15078, 699443, 100361558, 100169960, 480110, 326601, 100054462 |
Gene Symbol and Synonyms | BRYLIB1,EyeLinc14,H3-3A,H3-3B,H3.3A,H3F3,H3F3A,H3F3B |
Uniprot Accession | P84243 |
Uniprot Entry Name | H33_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000163041 |
Target Classification | Not Available |
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.