Human H3-3B/H3.3B ORF/cDNA clone-Lentivirus particle (NM_005324)

Pre-made Human H3-3B/H3.3B Lentiviral expression plasmid for H3-3B lentivirus packaging, H3-3B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to H3F3A/H3-3B/H3.3B products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003167 Human H3-3B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003167
Gene Name H3-3B
Accession Number NM_005324
Gene ID 3021
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 411 bp
Gene Alias H3.3B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCGAACCAAGCAGACTGCTCGTAAGTCCACCGGTGGGAAAGCCCCCCGCAAACAGCTGGCCACGAAAGCCGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAGAAGCCTCATCGCTACAGGCCCGGGACCGTGGCGCTTCGAGAGATTCGTCGTTATCAGAAGTCGACCGAGCTGCTCATCCGGAAGCTGCCCTTCCAGAGGTTGGTGAGGGAGATCGCGCAGGATTTCAAAACCGACCTGAGGTTTCAGAGCGCAGCCATCGGTGCGCTGCAGGAGGCTAGCGAAGCGTACCTGGTGGGTCTGTTCGAAGATACCAACCTGTGTGCCATCCACGCTAAGAGAGTCACCATCATGCCCAAAGACATCCAGTTGGCTCGCCGGATACGGGGAGAGAGAGCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T90766-Ab Anti-H3F3A monoclonal antibody
    Target Antigen GM-Tg-g-T90766-Ag H3F3A protein
    ORF Viral Vector pGMAAV000030 Human H3-3B Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP003167 Human H3-3B Lentivirus plasmid
    ORF Viral Vector pGMLP004571 Human H3-3A Lentivirus plasmid
    ORF Viral Vector vGMAAV000030 Human H3-3B Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003167 Human H3-3B Lentivirus particle
    ORF Viral Vector vGMLP004571 Human H3-3A Lentivirus particle


    Target information

    Target ID GM-T90766
    Target Name H3F3A
    Gene ID 3020, 15078, 699443, 100361558, 100169960, 480110, 326601, 100054462
    Gene Symbol and Synonyms BRYLIB1,EyeLinc14,H3-3A,H3-3B,H3.3A,H3F3,H3F3A,H3F3B
    Uniprot Accession P84243
    Uniprot Entry Name H33_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163041
    Target Classification Not Available

    Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.