Human FFAR2/FFA2R/ GPR43 ORF/cDNA clone-Lentivirus particle (NM_005306)

Pre-made Human FFAR2/FFA2R/ GPR43 Lentiviral expression plasmid for FFAR2 lentivirus packaging, FFAR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FFAR2/FFA2R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003179 Human FFAR2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003179
Gene Name FFAR2
Accession Number NM_005306
Gene ID 2867
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 993 bp
Gene Alias FFA2R, GPR43
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCCGGACTGGAAGAGCTCCTTGATCCTCATGGCTTACATCATCATCTTCCTCACTGGCCTCCCTGCCAACCTCCTGGCCCTGCGGGCCTTTGTGGGGCGGATCCGCCAGCCCCAGCCTGCACCTGTGCACATCCTCCTGCTGAGCCTGACGCTGGCCGACCTCCTCCTGCTGCTGCTGCTGCCCTTCAAGATCATCGAGGCTGCGTCGAACTTCCGCTGGTACCTGCCCAAGGTCGTCTGCGCCCTCACGAGTTTTGGCTTCTACAGCAGCATCTACTGCAGCACGTGGCTCCTGGCGGGCATCAGCATCGAGCGCTACCTGGGAGTGGCTTTCCCCGTGCAGTACAAGCTCTCCCGCCGGCCTCTGTATGGAGTGATTGCAGCTCTGGTGGCCTGGGTTATGTCCTTTGGTCACTGCACCATCGTGATCATCGTTCAATACTTGAACACGACTGAGCAGGTCAGAAGTGGCAATGAAATTACCTGCTACGAGAACTTCACCGATAACCAGTTGGACGTGGTGCTGCCCGTGCGGCTGGAGCTGTGCCTGGTGCTCTTCTTCATCCCCATGGCAGTCACCATCTTCTGCTACTGGCGTTTTGTGTGGATCATGCTCTCCCAGCCCCTTGTGGGGGCCCAGAGGCGGCGCCGAGCCGTGGGGCTGGCTGTGGTGACGCTGCTCAATTTCCTGGTGTGCTTCGGACCTTACAACGTGTCCCACCTGGTGGGGTATCACCAGAGAAAAAGCCCCTGGTGGCGGTCAATAGCCGTGGTGTTCAGTTCACTCAACGCCAGTCTGGACCCCCTGCTCTTCTATTTCTCTTCTTCAGTGGTGCGCAGGGCATTTGGGAGAGGGCTGCAGGTGCTGCGGAATCAGGGCTCCTCCCTGTTGGGACGCAGAGGCAAAGACACAGCAGAGGGGACAAATGAGGACAGGGGTGTGGGTCAAGGAGAAGGGATGCCAAGTTCGGACTTCACTACAGAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T28213-Ab Anti-FFAR2/ FFA2R/ GPR43 monoclonal antibody
    Target Antigen GM-Tg-g-T28213-Ag FFAR2 VLP (virus-like particle)
    ORF Viral Vector pGMAD000023 Rat Ffar2 Adenovirus plasmid
    ORF Viral Vector pGMLP003179 Human FFAR2 Lentivirus plasmid
    ORF Viral Vector vGMAD000023 Rat Ffar2 Adenovirus particle
    ORF Viral Vector vGMLP003179 Human FFAR2 Lentivirus particle


    Target information

    Target ID GM-T28213
    Target Name FFAR2
    Gene ID 2867, 233079, 709026, 292794, 101082709, 484580
    Gene Symbol and Synonyms FFA2R,FFAR2,GPCR43,GPR43
    Uniprot Accession O15552
    Uniprot Entry Name FFAR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000126262
    Target Classification Not Available

    This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for short chain free fatty acids and may be involved in the inflammatory response and in regulating lipid plasma levels. [provided by RefSeq, Apr 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.