Human AGPAT2/1-AGPAT2/BSCL ORF/cDNA clone-Lentivirus particle (NM_001012727)
Cat. No.: vGMLP003223
Pre-made Human AGPAT2/1-AGPAT2/BSCL Lentiviral expression plasmid for AGPAT2 lentivirus packaging, AGPAT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
LPAATB/AGPAT2/1-AGPAT2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003223 | Human AGPAT2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003223 |
| Gene Name | AGPAT2 |
| Accession Number | NM_001012727 |
| Gene ID | 10555 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 741 bp |
| Gene Alias | 1-AGPAT2,BSCL,BSCL1,LPAAB,LPAAT-beta |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGCTGTGGCCGTGTCTGGCCGCGGCGCTGCTGTTGCTGCTGCTGCTGGTGCAGCTGAGCCGCGCGGCCGAGTTCTACGCCAAGGTCGCCCTGTACTGCGCGCTGTGCTTCACGGTGTCCGCCGTGGCCTCGCTCGTCTGCCTGCTGCGCCACGGCGGCCGGACGGTGGAGAACATGAGCATCATCGGCTGGTTCGTGCGAAGCTTCAAGTACTTTTACGGGCTCCGCTTCGAGGTGCGGGACCCGCGCAGGCTGCAGGAGGCCCGTCCCTGTGTCATCGTCTCCAACCACCAGAGCATCCTGGACATGATGGGCCTCATGGAGGTCCTTCCGGAGCGCTGCGTGCAGATCGCCAAGCGGGAGCTGCTCTTCCTGGGGCCCGTGGGCCTCATCATGTACCTCGGGGGCGTCTTCTTCATCAACCGGCAGCGCTCTAGCACTGCCATGACAGTGATGGCCGACCTGGGCGAGCGCATGGTCAGGGAGAACGTGCCCATCGTCCCCGTGGTGTACTCTTCCTTCTCCTCCTTCTACAACACCAAGAAGAAGTTCTTCACTTCAGGAACAGTCACAGTGCAGGTGCTGGAAGCCATCCCCACCAGCGGCCTCACTGCGGCGGACGTCCCTGCGCTCGTGGACACCTGCCACCGGGCCATGAGGACCACCTTCCTCCACATCTCCAAGACCCCCCAGGAGAACGGGGCCACTGCGGGGTCTGGCGTGCAGCCGGCCCAGTAG |
| ORF Protein Sequence | MELWPCLAAALLLLLLLVQLSRAAEFYAKVALYCALCFTVSAVASLVCLLRHGGRTVENMSIIGWFVRSFKYFYGLRFEVRDPRRLQEARPCVIVSNHQSILDMMGLMEVLPERCVQIAKRELLFLGPVGLIMYLGGVFFINRQRSSTAMTVMADLGERMVRENVPIVPVVYSSFSSFYNTKKKFFTSGTVTVQVLEAIPTSGLTAADVPALVDTCHRAMRTTFLHISKTPQENGATAGSGVQPAQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T32821-Ab | Anti-PLCB/ LPAATB/ AGPAT2 monoclonal antibody |
| Target Antigen | GM-Tg-g-T32821-Ag | LPAATB/AGPAT2 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003223 | Human AGPAT2 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003223 | Human AGPAT2 Lentivirus particle |
Target information
| Target ID | GM-T32821 |
| Target Name | LPAATB |
| Gene ID | 10555, 67512, 709753, 311821, 101094635, 491249, 512112, 100068797 |
| Gene Symbol and Synonyms | 1-AGPAT 2,1-AGPAT2,2510002J07Rik,AGPAT2,BSCL,BSCL1,LPAAB,LPAAT-beta,LPLAT2 |
| Uniprot Accession | O15120 |
| Uniprot Entry Name | PLCB_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000169692 |
| Target Classification | Not Available |
This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


