Human AGPAT2/1-AGPAT2/BSCL ORF/cDNA clone-Lentivirus particle (NM_001012727)

Cat. No.: vGMLP003223

Pre-made Human AGPAT2/1-AGPAT2/BSCL Lentiviral expression plasmid for AGPAT2 lentivirus packaging, AGPAT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to LPAATB/AGPAT2/1-AGPAT2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003223 Human AGPAT2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003223
Gene Name AGPAT2
Accession Number NM_001012727
Gene ID 10555
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 741 bp
Gene Alias 1-AGPAT2,BSCL,BSCL1,LPAAB,LPAAT-beta
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCTGTGGCCGTGTCTGGCCGCGGCGCTGCTGTTGCTGCTGCTGCTGGTGCAGCTGAGCCGCGCGGCCGAGTTCTACGCCAAGGTCGCCCTGTACTGCGCGCTGTGCTTCACGGTGTCCGCCGTGGCCTCGCTCGTCTGCCTGCTGCGCCACGGCGGCCGGACGGTGGAGAACATGAGCATCATCGGCTGGTTCGTGCGAAGCTTCAAGTACTTTTACGGGCTCCGCTTCGAGGTGCGGGACCCGCGCAGGCTGCAGGAGGCCCGTCCCTGTGTCATCGTCTCCAACCACCAGAGCATCCTGGACATGATGGGCCTCATGGAGGTCCTTCCGGAGCGCTGCGTGCAGATCGCCAAGCGGGAGCTGCTCTTCCTGGGGCCCGTGGGCCTCATCATGTACCTCGGGGGCGTCTTCTTCATCAACCGGCAGCGCTCTAGCACTGCCATGACAGTGATGGCCGACCTGGGCGAGCGCATGGTCAGGGAGAACGTGCCCATCGTCCCCGTGGTGTACTCTTCCTTCTCCTCCTTCTACAACACCAAGAAGAAGTTCTTCACTTCAGGAACAGTCACAGTGCAGGTGCTGGAAGCCATCCCCACCAGCGGCCTCACTGCGGCGGACGTCCCTGCGCTCGTGGACACCTGCCACCGGGCCATGAGGACCACCTTCCTCCACATCTCCAAGACCCCCCAGGAGAACGGGGCCACTGCGGGGTCTGGCGTGCAGCCGGCCCAGTAG
ORF Protein Sequence MELWPCLAAALLLLLLLVQLSRAAEFYAKVALYCALCFTVSAVASLVCLLRHGGRTVENMSIIGWFVRSFKYFYGLRFEVRDPRRLQEARPCVIVSNHQSILDMMGLMEVLPERCVQIAKRELLFLGPVGLIMYLGGVFFINRQRSSTAMTVMADLGERMVRENVPIVPVVYSSFSSFYNTKKKFFTSGTVTVQVLEAIPTSGLTAADVPALVDTCHRAMRTTFLHISKTPQENGATAGSGVQPAQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32821-Ab Anti-PLCB/ LPAATB/ AGPAT2 monoclonal antibody
    Target Antigen GM-Tg-g-T32821-Ag LPAATB/AGPAT2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003223 Human AGPAT2 Lentivirus plasmid
    ORF Viral Vector vGMLP003223 Human AGPAT2 Lentivirus particle


    Target information

    Target ID GM-T32821
    Target Name LPAATB
    Gene ID 10555, 67512, 709753, 311821, 101094635, 491249, 512112, 100068797
    Gene Symbol and Synonyms 1-AGPAT 2,1-AGPAT2,2510002J07Rik,AGPAT2,BSCL,BSCL1,LPAAB,LPAAT-beta,LPLAT2
    Uniprot Accession O15120
    Uniprot Entry Name PLCB_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000169692
    Target Classification Not Available

    This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.