Human ADRA1A/ADRA1C/ ADRA1L1 ORF/cDNA clone-Lentivirus particle (NM_033303)

Pre-made Human ADRA1A/ADRA1C/ ADRA1L1 Lentiviral expression plasmid for ADRA1A lentivirus packaging, ADRA1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ADRA1A/ADRA1C products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003225 Human ADRA1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003225
Gene Name ADRA1A
Accession Number NM_033303
Gene ID 148
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1428 bp
Gene Alias ADRA1C, ADRA1L1, ALPHA1AAR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGTTTCTCTCGGGAAATGCTTCCGACAGCTCCAACTGCACCCAACCGCCGGCACCGGTGAACATTTCCAAGGCCATTCTGCTCGGGGTGATCTTGGGGGGCCTCATTCTTTTCGGGGTGCTGGGTAACATCCTAGTGATCCTCTCCGTAGCCTGTCACCGACACCTGCACTCAGTCACGCACTACTACATCGTCAACCTGGCGGTGGCCGACCTCCTGCTCACCTCCACGGTGCTGCCCTTCTCCGCCATCTTCGAGGTCCTAGGCTACTGGGCCTTCGGCAGGGTCTTCTGCAACATCTGGGCGGCAGTGGATGTGCTGTGCTGCACCGCGTCCATCATGGGCCTCTGCATCATCTCCATCGACCGCTACATCGGCGTGAGCTACCCGCTGCGCTACCCAACCATCGTCACCCAGAGGAGGGGTCTCATGGCTCTGCTCTGCGTCTGGGCACTCTCCCTGGTCATATCCATTGGACCCCTGTTCGGCTGGAGGCAGCCGGCCCCCGAGGACGAGACCATCTGCCAGATCAACGAGGAGCCGGGCTACGTGCTCTTCTCAGCGCTGGGCTCCTTCTACCTGCCTCTGGCCATCATCCTGGTCATGTACTGCCGCGTCTACGTGGTGGCCAAGAGGGAGAGCCGGGGCCTCAAGTCTGGCCTCAAGACCGACAAGTCGGACTCGGAGCAAGTGACGCTCCGCATCCATCGGAAAAACGCCCCGGCAGGAGGCAGCGGGATGGCCAGCGCCAAGACCAAGACGCACTTCTCAGTGAGGCTCCTCAAGTTCTCCCGGGAGAAGAAAGCGGCCAAAACGCTGGGCATCGTGGTCGGCTGCTTCGTCCTCTGCTGGCTGCCTTTTTTCTTAGTCATGCCCATTGGGTCTTTCTTCCCTGATTTCAAGCCCTCTGAAACAGTTTTTAAAATAGTATTTTGGCTCGGATATCTAAACAGCTGCATCAACCCCATCATATACCCATGCTCCAGCCAAGAGTTCAAAAAGGCCTTTCAGAATGTCTTGAGAATCCAGTGTCTCTGCAGAAAGCAGTCTTCCAAACATGCCCTGGGCTACACCCTGCACCCGCCCAGCCAGGCCGTGGAAGGGCAACACAAGGACATGGTGCGCATCCCCGTGGGATCAAGAGAGACCTTCTACAGGATCTCCAAGACGGATGGCGTTTGTGAATGGAAATTTTTCTCTTCCATGCCCCGTGGATCTGCCAGGATTACAGTGTCCAAAGACCAATCCTCCTGTACCACAGCCCGGACGAAGTCTCGCTCTGTCACCAGGCTGGAGTGCAGTGGCATGATCTTGGCTCACTGCAACCTCCGCCTCCCGGGTTCAAGAGATTCTCCTGCCTCAGCCTCCCAAGCAGCTGGGACTACAGGGATGTGCCACCAGGCCGACGCCACCAGGCCCAGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92609-Ab Anti-ADA1A/ ADRA1A/ ADRA1C monoclonal antibody
    Target Antigen GM-Tg-g-T92609-Ag ADRA1A VLP (virus-like particle)
    ORF Viral Vector pGMLP003225 Human ADRA1A Lentivirus plasmid
    ORF Viral Vector vGMLP003225 Human ADRA1A Lentivirus particle


    Target information

    Target ID GM-T92609
    Target Name ADRA1A
    Gene ID 148, 11549, 712509, 29412, 101098375, 403866, 282134, 100054461
    Gene Symbol and Synonyms ADRA1A,ADRA1C,ADRA1L1,ALPHA-1A,ALPHA1AAR
    Uniprot Accession P35348
    Uniprot Entry Name ADA1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000120907
    Target Classification GPCR

    Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1A-adrenergic receptor. Alternative splicing of this gene generates four transcript variants, which encode four different isoforms with distinct C-termini but having similar ligand binding properties. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.