Human BSCL2/GNG3LG/ HMN5 ORF/cDNA clone-Lentivirus particle (NM_032667)

Pre-made Human BSCL2/GNG3LG/ HMN5 Lentiviral expression plasmid for BSCL2 lentivirus packaging, BSCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to BSCL2/GNG3LG products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003362 Human BSCL2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003362
Gene Name BSCL2
Accession Number NM_032667
Gene ID 26580
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1197 bp
Gene Alias GNG3LG, HMN5, PELD, SPG17
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCAACGACCCTCCAGTACCTGCCTTACTGTGGGCCCAGGAGGTGGGCCAAGTCTTGGCAGGCCGTGCCCGCAGGCTGCTGCTGCAGTTTGGGGTGCTCTTCTGCACCATCCTCCTTTTGCTCTGGGTGTCTGTCTTCCTCTATGGCTCCTTCTACTATTCCTATATGCCGACAGTCAGCCACCTCAGCCCTGTGCATTTCTACTACAGGACCGACTGTGATTCCTCCACCACCTCACTCTGCTCCTTCCCTGTTGCCAATGTCTCGCTGACTAAGGGTGGACGTGATCGGGTGCTGATGTATGGACAGCCGTATCGTGTTACCTTAGAGCTTGAGCTGCCAGAGTCCCCTGTGAATCAAGATTTGGGCATGTTCTTGGTCACCATTTCCTGCTACACCAGAGGTGGCCGAATCATCTCCACTTCTTCGCGTTCGGTGATGCTGCATTACCGCTCAGACCTGCTCCAGATGCTGGACACACTGGTCTTCTCTAGCCTCCTGCTATTTGGCTTTGCAGAGCAGAAGCAGCTGCTGGAGGTGGAACTCTACGCAGACTATAGAGAGAACTCGTACGTGCCGACCACTGGAGCGATCATTGAGATCCACAGCAAGCGCATCCAGCTGTATGGAGCCTACCTCCGCATCCACGCGCACTTCACTGGGCTCAGATACCTGCTATACAACTTCCCGATGACCTGCGCCTTCATAGGTGTTGCCAGCAACTTCACCTTCCTCAGCGTCATCGTGCTCTTCAGCTACATGCAGTGGGTGTGGGGGGGCATCTGGCCCCGACACCGCTTCTCTTTGCAGGTTAACATCCGAAAAAGAGACAATTCCCGGAAGGAAGTCCAACGAAGGATCTCTGCTCATCAGCCAGGGCCTGAAGGCCAGGAGGAGTCAACTCCGCAATCAGATGTTACAGAGGATGGTGAGAGCCCTGAAGATCCCTCAGGGACAGAGGGTCAGCTGTCCGAGGAGGAGAAACCAGATCAGCAGCCCCTGAGCGGAGAAGAGGAGCTAGAGCCTGAGGCCAGTGATGGTTCAGGCTCCTGGGAAGATGCAGCTTTGCTGACGGAGGCCAACCTGCCTGCTCCTGCTCCTGCTTCTGCTTCTGCCCCTGTCCTAGAGACTCTGGGCAGCTCTGAACCTGCTGGGGGTGCTCTCCGACAGCGCCCCACCTGCTCTAGTTCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0432-Ab Anti-BSCL2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0432-Ag BSCL2 protein
    ORF Viral Vector pGMAAV000012 Human BSCL2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP003362 Human BSCL2 Lentivirus plasmid
    ORF Viral Vector vGMAAV000012 Human BSCL2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003362 Human BSCL2 Lentivirus particle


    Target information

    Target ID GM-IP0432
    Target Name BSCL2
    Gene ID 26580, 14705, 100428843, 361722, 101091148, 476054, 513558, 100063764
    Gene Symbol and Synonyms 2900097C17Rik,BSCL2,GNG3LG,HMN5,HMN5C,PELD,SPG17
    Uniprot Accession Q96G97
    Uniprot Entry Name BSCL2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000168000
    Target Classification Not Available

    This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.