Human BSCL2/GNG3LG/ HMN5 ORF/cDNA clone-Lentivirus particle (NM_032667)
Pre-made Human BSCL2/GNG3LG/ HMN5 Lentiviral expression plasmid for BSCL2 lentivirus packaging, BSCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BSCL2/GNG3LG products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003362 | Human BSCL2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003362 |
Gene Name | BSCL2 |
Accession Number | NM_032667 |
Gene ID | 26580 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1197 bp |
Gene Alias | GNG3LG, HMN5, PELD, SPG17 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTCAACGACCCTCCAGTACCTGCCTTACTGTGGGCCCAGGAGGTGGGCCAAGTCTTGGCAGGCCGTGCCCGCAGGCTGCTGCTGCAGTTTGGGGTGCTCTTCTGCACCATCCTCCTTTTGCTCTGGGTGTCTGTCTTCCTCTATGGCTCCTTCTACTATTCCTATATGCCGACAGTCAGCCACCTCAGCCCTGTGCATTTCTACTACAGGACCGACTGTGATTCCTCCACCACCTCACTCTGCTCCTTCCCTGTTGCCAATGTCTCGCTGACTAAGGGTGGACGTGATCGGGTGCTGATGTATGGACAGCCGTATCGTGTTACCTTAGAGCTTGAGCTGCCAGAGTCCCCTGTGAATCAAGATTTGGGCATGTTCTTGGTCACCATTTCCTGCTACACCAGAGGTGGCCGAATCATCTCCACTTCTTCGCGTTCGGTGATGCTGCATTACCGCTCAGACCTGCTCCAGATGCTGGACACACTGGTCTTCTCTAGCCTCCTGCTATTTGGCTTTGCAGAGCAGAAGCAGCTGCTGGAGGTGGAACTCTACGCAGACTATAGAGAGAACTCGTACGTGCCGACCACTGGAGCGATCATTGAGATCCACAGCAAGCGCATCCAGCTGTATGGAGCCTACCTCCGCATCCACGCGCACTTCACTGGGCTCAGATACCTGCTATACAACTTCCCGATGACCTGCGCCTTCATAGGTGTTGCCAGCAACTTCACCTTCCTCAGCGTCATCGTGCTCTTCAGCTACATGCAGTGGGTGTGGGGGGGCATCTGGCCCCGACACCGCTTCTCTTTGCAGGTTAACATCCGAAAAAGAGACAATTCCCGGAAGGAAGTCCAACGAAGGATCTCTGCTCATCAGCCAGGGCCTGAAGGCCAGGAGGAGTCAACTCCGCAATCAGATGTTACAGAGGATGGTGAGAGCCCTGAAGATCCCTCAGGGACAGAGGGTCAGCTGTCCGAGGAGGAGAAACCAGATCAGCAGCCCCTGAGCGGAGAAGAGGAGCTAGAGCCTGAGGCCAGTGATGGTTCAGGCTCCTGGGAAGATGCAGCTTTGCTGACGGAGGCCAACCTGCCTGCTCCTGCTCCTGCTTCTGCTTCTGCCCCTGTCCTAGAGACTCTGGGCAGCTCTGAACCTGCTGGGGGTGCTCTCCGACAGCGCCCCACCTGCTCTAGTTCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0432-Ab | Anti-BSCL2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0432-Ag | BSCL2 protein |
ORF Viral Vector | pGMAAV000012 | Human BSCL2 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP003362 | Human BSCL2 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000012 | Human BSCL2 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP003362 | Human BSCL2 Lentivirus particle |
Target information
Target ID | GM-IP0432 |
Target Name | BSCL2 |
Gene ID | 26580, 14705, 100428843, 361722, 101091148, 476054, 513558, 100063764 |
Gene Symbol and Synonyms | 2900097C17Rik,BSCL2,GNG3LG,HMN5,HMN5C,PELD,SPG17 |
Uniprot Accession | Q96G97 |
Uniprot Entry Name | BSCL2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000168000 |
Target Classification | Not Available |
This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.