Human TMEM97/MAC30 ORF/cDNA clone-Lentivirus particle (NM_014573)

Cat. No.: vGMLP003422

Pre-made Human TMEM97/MAC30 Lentiviral expression plasmid for TMEM97 lentivirus packaging, TMEM97 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TMEM97/MAC30 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003422 Human TMEM97 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003422
Gene Name TMEM97
Accession Number NM_014573
Gene ID 27346
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 531 bp
Gene Alias MAC30
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGGCTCCGGCAACCAGGCGCTGCGTGGAGTGGCTGCTGGGCCTCTACTTCCTCAGCCACATCCCCATCACCCTGTTCATGGACCTGCAGGCGGTGCTGCCGCGCGAGCTCTACCCAGTCGAGTTTAGAAACCTGCTGAAGTGGTATGCTAAGGAGTTCAAAGACCCACTGCTACAGGAGCCCCCAGCCTGGTTTAAGTCCTTTCTGTTTTGCGAGCTTGTGTTTCAGCTGCCTTTCTTTCCCATTGCAACGTATGCCTTCCTCAAAGGAAGCTGCAAGTGGATTCGAACTCCTGCAATCATCTACTCTGTTCACACCATGACAACCTTAATTCCGATACTCTCCACATTTCTGTTTGAGGATTTCTCCAAAGCCAGTGGTTTCAAGGGACAAAGACCTGAGACTTTGCATGAACGGTTAACCCTTGTGTCTGTCTATGCCCCCTACTTACTCATCCCATTCATACTTTTAATTTTCATGTTGCGGAGCCCCTACTACAAGTATGAAGAGAAAAGAAAAAAAAAATGA
ORF Protein Sequence MGAPATRRCVEWLLGLYFLSHIPITLFMDLQAVLPRELYPVEFRNLLKWYAKEFKDPLLQEPPAWFKSFLFCELVFQLPFFPIATYAFLKGSCKWIRTPAIIYSVHTMTTLIPILSTFLFEDFSKASGFKGQRPETLHERLTLVSVYAPYLLIPFILLIFMLRSPYYKYEEKRKKK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T45674-Ab Anti-SGMR2/ TMEM97/ MAC30 monoclonal antibody
    Target Antigen GM-Tg-g-T45674-Ag TMEM97 VLP (virus-like particle)
    ORF Viral Vector pGMLP003422 Human TMEM97 Lentivirus plasmid
    ORF Viral Vector vGMLP003422 Human TMEM97 Lentivirus particle


    Target information

    Target ID GM-T45674
    Target Name TMEM97
    Gene ID 27346, 69071, 707879, 303330, 101080494, 610900, 511378, 100058915
    Gene Symbol and Synonyms 1810014L12Rik,D11Bhm182e,MAC30,RGD1307423,sigma2R,TMEM97
    Uniprot Accession Q5BJF2
    Uniprot Entry Name SGMR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000109084
    Target Classification Not Available

    TMEM97 is a conserved integral membrane protein that plays a role in controlling cellular cholesterol levels (Bartz et al., 2009 [PubMed 19583955]).[supplied by OMIM, Aug 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.