Human FGF4/FGF-4/ HBGF-4 ORF/cDNA clone-Lentivirus particle (NM_002007)

Pre-made Human FGF4/FGF-4/ HBGF-4 Lentiviral expression plasmid for FGF4 lentivirus packaging, FGF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FGF4/FGF-4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003446 Human FGF4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003446
Gene Name FGF4
Accession Number NM_002007
Gene ID 2249
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 621 bp
Gene Alias FGF-4, HBGF-4, HST, HST-1, HSTF-1, HSTF1, K-FGF, KFGF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCGGGGCCCGGGACGGCCGCGGTAGCGCTGCTCCCGGCGGTCCTGCTGGCCTTGCTGGCGCCCTGGGCGGGCCGAGGGGGCGCCGCCGCACCCACTGCACCCAACGGCACGCTGGAGGCCGAGCTGGAGCGCCGCTGGGAGAGCCTGGTGGCGCTCTCGTTGGCGCGCCTGCCGGTGGCAGCGCAGCCCAAGGAGGCGGCCGTCCAGAGCGGCGCCGGCGACTACCTGCTGGGCATCAAGCGGCTGCGGCGGCTCTACTGCAACGTGGGCATCGGCTTCCACCTCCAGGCGCTCCCCGACGGCCGCATCGGCGGCGCGCACGCGGACACCCGCGACAGCCTGCTGGAGCTCTCGCCCGTGGAGCGGGGCGTGGTGAGCATCTTCGGCGTGGCCAGCCGGTTCTTCGTGGCCATGAGCAGCAAGGGCAAGCTCTATGGCTCGCCCTTCTTCACCGATGAGTGCACGTTCAAGGAGATTCTCCTTCCCAACAACTACAACGCCTACGAGTCCTACAAGTACCCCGGCATGTTCATCGCCCTGAGCAAGAATGGGAAGACCAAGAAGGGGAACCGAGTGTCGCCCACCATGAAGGTCACCCACTTCCTCCCCAGGCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T28076-Ab Anti-FGF4/ FGF-4/ HBGF-4 functional antibody
    Target Antigen GM-Tg-g-T28076-Ag FGF4 protein
    Cytokine cks-Tg-g-GM-T28076 fibroblast growth factor 4 (FGF4) protein & antibody
    ORF Viral Vector pGMLP003446 Human FGF4 Lentivirus plasmid
    ORF Viral Vector vGMLP003446 Human FGF4 Lentivirus particle


    Target information

    Target ID GM-T28076
    Target Name FGF4
    Gene ID 2249, 14175, 709016, 116499, 111556546, 483680, 618474, 100060525
    Gene Symbol and Synonyms FGF-4,FGF4,Fgf7a,Fgfk,HBGF-4,HST,HST-1,Hst1,HSTF-1,HSTF1,K-FGF,KFGF,KS3
    Uniprot Accession P08620
    Uniprot Entry Name FGF4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000075388
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its oncogenic transforming activity. This gene and FGF3, another oncogenic growth factor, are located closely on chromosome 11. Co-amplification of both genes was found in various kinds of human tumors. Studies on the mouse homolog suggested a function in bone morphogenesis and limb development through the sonic hedgehog (SHH) signaling pathway. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.