Human FGF4/FGF-4/ HBGF-4 ORF/cDNA clone-Lentivirus particle (NM_002007)
Pre-made Human FGF4/FGF-4/ HBGF-4 Lentiviral expression plasmid for FGF4 lentivirus packaging, FGF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FGF4/FGF-4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003446 | Human FGF4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003446 |
Gene Name | FGF4 |
Accession Number | NM_002007 |
Gene ID | 2249 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 621 bp |
Gene Alias | FGF-4, HBGF-4, HST, HST-1, HSTF-1, HSTF1, K-FGF, KFGF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCGGGGCCCGGGACGGCCGCGGTAGCGCTGCTCCCGGCGGTCCTGCTGGCCTTGCTGGCGCCCTGGGCGGGCCGAGGGGGCGCCGCCGCACCCACTGCACCCAACGGCACGCTGGAGGCCGAGCTGGAGCGCCGCTGGGAGAGCCTGGTGGCGCTCTCGTTGGCGCGCCTGCCGGTGGCAGCGCAGCCCAAGGAGGCGGCCGTCCAGAGCGGCGCCGGCGACTACCTGCTGGGCATCAAGCGGCTGCGGCGGCTCTACTGCAACGTGGGCATCGGCTTCCACCTCCAGGCGCTCCCCGACGGCCGCATCGGCGGCGCGCACGCGGACACCCGCGACAGCCTGCTGGAGCTCTCGCCCGTGGAGCGGGGCGTGGTGAGCATCTTCGGCGTGGCCAGCCGGTTCTTCGTGGCCATGAGCAGCAAGGGCAAGCTCTATGGCTCGCCCTTCTTCACCGATGAGTGCACGTTCAAGGAGATTCTCCTTCCCAACAACTACAACGCCTACGAGTCCTACAAGTACCCCGGCATGTTCATCGCCCTGAGCAAGAATGGGAAGACCAAGAAGGGGAACCGAGTGTCGCCCACCATGAAGGTCACCCACTTCCTCCCCAGGCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T28076-Ab | Anti-FGF4/ FGF-4/ HBGF-4 functional antibody |
Target Antigen | GM-Tg-g-T28076-Ag | FGF4 protein |
Cytokine | cks-Tg-g-GM-T28076 | fibroblast growth factor 4 (FGF4) protein & antibody |
ORF Viral Vector | pGMLP003446 | Human FGF4 Lentivirus plasmid |
ORF Viral Vector | vGMLP003446 | Human FGF4 Lentivirus particle |
Target information
Target ID | GM-T28076 |
Target Name | FGF4 |
Gene ID | 2249, 14175, 709016, 116499, 111556546, 483680, 618474, 100060525 |
Gene Symbol and Synonyms | FGF-4,FGF4,Fgf7a,Fgfk,HBGF-4,HST,HST-1,Hst1,HSTF-1,HSTF1,K-FGF,KFGF,KS3 |
Uniprot Accession | P08620 |
Uniprot Entry Name | FGF4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000075388 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its oncogenic transforming activity. This gene and FGF3, another oncogenic growth factor, are located closely on chromosome 11. Co-amplification of both genes was found in various kinds of human tumors. Studies on the mouse homolog suggested a function in bone morphogenesis and limb development through the sonic hedgehog (SHH) signaling pathway. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.