Human CLCF1/BSF-3/ BSF3 ORF/cDNA clone-Lentivirus particle (NM_013246)
Pre-made Human CLCF1/BSF-3/ BSF3 Lentiviral expression plasmid for CLCF1 lentivirus packaging, CLCF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CLCF1/BSF-3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003461 | Human CLCF1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003461 |
Gene Name | CLCF1 |
Accession Number | NM_013246 |
Gene ID | 23529 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 678 bp |
Gene Alias | BSF-3, BSF3, CISS2, CLC, NNT-1, NNT1, NR6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACCTCCGAGCAGGGGACTCGTGGGGGATGTTAGCGTGCCTGTGCACGGTGCTCTGGCACCTCCCTGCAGTGCCAGCTCTCAATCGCACAGGGGACCCAGGGCCTGGCCCCTCCATCCAGAAAACCTATGACCTCACCCGCTACCTGGAGCACCAACTCCGCAGCTTGGCTGGGACCTATCTGAACTACCTGGGCCCCCCTTTCAACGAGCCAGACTTCAACCCTCCCCGCCTGGGGGCAGAGACTCTGCCCAGGGCCACTGTTGACTTGGAGGTGTGGCGAAGCCTCAATGACAAACTGCGGCTGACCCAGAACTACGAGGCCTACAGCCACCTTCTGTGTTACTTGCGTGGCCTCAACCGTCAGGCTGCCACTGCTGAGCTGCGCCGCAGCCTGGCCCACTTCTGCACCAGCCTCCAGGGCCTGCTGGGCAGCATTGCGGGCGTCATGGCAGCTCTGGGCTACCCACTGCCCCAGCCGCTGCCTGGGACTGAACCCACTTGGACTCCTGGCCCTGCCCACAGTGACTTCCTCCAGAAGATGGACGACTTCTGGCTGCTGAAGGAGCTGCAGACCTGGCTGTGGCGCTCGGCCAAGGACTTCAACCGGCTCAAGAAGAAGATGCAGCCTCCAGCAGCTGCAGTCACCCTGCACCTGGGGGCTCATGGCTTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T84019-Ab | Anti-CLCF1/ BSF-3/ BSF3 functional antibody |
Target Antigen | GM-Tg-g-T84019-Ag | CLCF1 protein |
Cytokine | cks-Tg-g-GM-T84019 | cardiotrophin-like cytokine factor 1 (CLCF1) protein & antibody |
ORF Viral Vector | pGMLP003461 | Human CLCF1 Lentivirus plasmid |
ORF Viral Vector | vGMLP003461 | Human CLCF1 Lentivirus particle |
ORF Viral Vector | pGMLV002318 | Mouse Clcf1 Lentivirus plasmid |
Target information
Target ID | GM-T84019 |
Target Name | CLCF1 |
Gene ID | 23529, 56708, 712554, 365395, 101101338, 483697, 100336481, 100146651 |
Gene Symbol and Synonyms | BSF-3,BSF3,CISS2,CLC,CLCF1,NNT-1,NNT1,NR6 |
Uniprot Accession | Q9UBD9 |
Uniprot Entry Name | CLCF1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000175505 |
Target Classification | Not Available |
This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.