Human CLCF1/BSF-3/ BSF3 ORF/cDNA clone-Lentivirus particle (NM_013246)

Pre-made Human CLCF1/BSF-3/ BSF3 Lentiviral expression plasmid for CLCF1 lentivirus packaging, CLCF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CLCF1/BSF-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003461 Human CLCF1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003461
Gene Name CLCF1
Accession Number NM_013246
Gene ID 23529
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 678 bp
Gene Alias BSF-3, BSF3, CISS2, CLC, NNT-1, NNT1, NR6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACCTCCGAGCAGGGGACTCGTGGGGGATGTTAGCGTGCCTGTGCACGGTGCTCTGGCACCTCCCTGCAGTGCCAGCTCTCAATCGCACAGGGGACCCAGGGCCTGGCCCCTCCATCCAGAAAACCTATGACCTCACCCGCTACCTGGAGCACCAACTCCGCAGCTTGGCTGGGACCTATCTGAACTACCTGGGCCCCCCTTTCAACGAGCCAGACTTCAACCCTCCCCGCCTGGGGGCAGAGACTCTGCCCAGGGCCACTGTTGACTTGGAGGTGTGGCGAAGCCTCAATGACAAACTGCGGCTGACCCAGAACTACGAGGCCTACAGCCACCTTCTGTGTTACTTGCGTGGCCTCAACCGTCAGGCTGCCACTGCTGAGCTGCGCCGCAGCCTGGCCCACTTCTGCACCAGCCTCCAGGGCCTGCTGGGCAGCATTGCGGGCGTCATGGCAGCTCTGGGCTACCCACTGCCCCAGCCGCTGCCTGGGACTGAACCCACTTGGACTCCTGGCCCTGCCCACAGTGACTTCCTCCAGAAGATGGACGACTTCTGGCTGCTGAAGGAGCTGCAGACCTGGCTGTGGCGCTCGGCCAAGGACTTCAACCGGCTCAAGAAGAAGATGCAGCCTCCAGCAGCTGCAGTCACCCTGCACCTGGGGGCTCATGGCTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T84019-Ab Anti-CLCF1/ BSF-3/ BSF3 functional antibody
    Target Antigen GM-Tg-g-T84019-Ag CLCF1 protein
    Cytokine cks-Tg-g-GM-T84019 cardiotrophin-like cytokine factor 1 (CLCF1) protein & antibody
    ORF Viral Vector pGMLP003461 Human CLCF1 Lentivirus plasmid
    ORF Viral Vector vGMLP003461 Human CLCF1 Lentivirus particle
    ORF Viral Vector pGMLV002318 Mouse Clcf1 Lentivirus plasmid


    Target information

    Target ID GM-T84019
    Target Name CLCF1
    Gene ID 23529, 56708, 712554, 365395, 101101338, 483697, 100336481, 100146651
    Gene Symbol and Synonyms BSF-3,BSF3,CISS2,CLC,CLCF1,NNT-1,NNT1,NR6
    Uniprot Accession Q9UBD9
    Uniprot Entry Name CLCF1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000175505
    Target Classification Not Available

    This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.