Human AQP7/AQP7L/AQPap ORF/cDNA clone-Lentivirus particle (NM_001170)

Cat. No.: vGMLP003560

Pre-made Human AQP7/AQP7L/AQPap Lentiviral expression plasmid for AQP7 lentivirus packaging, AQP7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AQP7/AQP7L products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003560 Human AQP7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003560
Gene Name AQP7
Accession Number NM_001170
Gene ID 364
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1029 bp
Gene Alias AQP7L,AQPap,GLYCQTL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTTCAAGCATCCGGGCACAGGCGGTCCACCCGTGGCTCCAAAATGGTCTCCTGGTCCGTGATAGCAAAGATCCAGGAAATACTGCAGAGGAAGATGGTGCGAGAGTTCCTGGCCGAGTTCATGAGCACATATGTCATGATGGTATTCGGCCTTGGTTCCGTGGCCCATATGGTTCTAAATAAAAAATATGGGAGCTACCTTGGTGTCAACTTGGGTTTTGGCTTCGGAGTCACCATGGGAGTGCACGTGGCAGGCCGCATCTCTGGAGCCCACATGAACGCAGCTGTGACCTTTGCTAACTGTGCGCTGGGCCGCGTGCCCTGGAGGAAGTTTCCGGTCTATGTGCTGGGGCAGTTCCTGGGCTCCTTCCTGGCGGCTGCCACCATCTACAGTCTCTTCTACACGGCCATTCTCCACTTTTCGGGTGGACAGCTGATGGTGACCGGTCCCGTCGCTACAGCTGGCATTTTTGCCACCTACCTTCCTGATCACATGACATTGTGGCGGGGCTTCCTGAATGAGGCGTGGCTGACCGGGATGCTCCAGCTGTGTCTCTTCGCCATCACGGACCAGGAGAACAACCCAGCACTGCCAGGAACAGAGGCGCTGGTGATAGGCATCCTCGTGGTCATCATCGGGGTGTCCCTTGGCATGAACACAGGATATGCCATCAACCCGTCCCGGGACCTGCCCCCCCGCATCTTCACCTTCATTGCTGGTTGGGGCAAACAGGTCTTCAGCAATGGGGAGAACTGGTGGTGGGTGCCAGTGGTGGCACCACTTCTGGGTGCCTATCTAGGTGGCATCATCTACCTGGTCTTCATTGGCTCCACCATCCCACGGGAGCCCCTGAAATTGGAGGATTCTGTGGCGTATGAAGACCACGGGATAACCGTATTGCCCAAGATGGGATCTCATGAACCCACGATCTCTCCCCTCACCCCCGTCTCTGTGAGCCCTGCCAACAGATCTTCAGTCCACCCTGCCCCACCCTTACATGAATCCATGGCCCTAGAGCACTTCTAA
ORF Protein Sequence MVQASGHRRSTRGSKMVSWSVIAKIQEILQRKMVREFLAEFMSTYVMMVFGLGSVAHMVLNKKYGSYLGVNLGFGFGVTMGVHVAGRISGAHMNAAVTFANCALGRVPWRKFPVYVLGQFLGSFLAAATIYSLFYTAILHFSGGQLMVTGPVATAGIFATYLPDHMTLWRGFLNEAWLTGMLQLCLFAITDQENNPALPGTEALVIGILVVIIGVSLGMNTGYAINPSRDLPPRIFTFIAGWGKQVFSNGENWWWVPVVAPLLGAYLGGIIYLVFIGSTIPREPLKLEDSVAYEDHGITVLPKMGSHEPTISPLTPVSVSPANRSSVHPAPPLHESMALEHF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T94438-Ab Anti-AQP7/ AQP7L/ AQPap monoclonal antibody
    Target Antigen GM-Tg-g-T94438-Ag AQP7 VLP (virus-like particle)
    ORF Viral Vector pGMLP003560 Human AQP7 Lentivirus plasmid
    ORF Viral Vector vGMLP003560 Human AQP7 Lentivirus particle


    Target information

    Target ID GM-T94438
    Target Name AQP7
    Gene ID 364, 11832, 702836, 29171, 101101423, 474742, 615498, 100068324
    Gene Symbol and Synonyms AQP7,AQP7L,AQPap,GLYCQTL
    Uniprot Accession O14520
    Uniprot Entry Name AQP7_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000165269
    Target Classification Not Available

    This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.