Human AQP7/AQP7L/AQPap ORF/cDNA clone-Lentivirus particle (NM_001170)
Cat. No.: vGMLP003560
Pre-made Human AQP7/AQP7L/AQPap Lentiviral expression plasmid for AQP7 lentivirus packaging, AQP7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
AQP7/AQP7L products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003560 | Human AQP7 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003560 |
| Gene Name | AQP7 |
| Accession Number | NM_001170 |
| Gene ID | 364 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1029 bp |
| Gene Alias | AQP7L,AQPap,GLYCQTL |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGTTCAAGCATCCGGGCACAGGCGGTCCACCCGTGGCTCCAAAATGGTCTCCTGGTCCGTGATAGCAAAGATCCAGGAAATACTGCAGAGGAAGATGGTGCGAGAGTTCCTGGCCGAGTTCATGAGCACATATGTCATGATGGTATTCGGCCTTGGTTCCGTGGCCCATATGGTTCTAAATAAAAAATATGGGAGCTACCTTGGTGTCAACTTGGGTTTTGGCTTCGGAGTCACCATGGGAGTGCACGTGGCAGGCCGCATCTCTGGAGCCCACATGAACGCAGCTGTGACCTTTGCTAACTGTGCGCTGGGCCGCGTGCCCTGGAGGAAGTTTCCGGTCTATGTGCTGGGGCAGTTCCTGGGCTCCTTCCTGGCGGCTGCCACCATCTACAGTCTCTTCTACACGGCCATTCTCCACTTTTCGGGTGGACAGCTGATGGTGACCGGTCCCGTCGCTACAGCTGGCATTTTTGCCACCTACCTTCCTGATCACATGACATTGTGGCGGGGCTTCCTGAATGAGGCGTGGCTGACCGGGATGCTCCAGCTGTGTCTCTTCGCCATCACGGACCAGGAGAACAACCCAGCACTGCCAGGAACAGAGGCGCTGGTGATAGGCATCCTCGTGGTCATCATCGGGGTGTCCCTTGGCATGAACACAGGATATGCCATCAACCCGTCCCGGGACCTGCCCCCCCGCATCTTCACCTTCATTGCTGGTTGGGGCAAACAGGTCTTCAGCAATGGGGAGAACTGGTGGTGGGTGCCAGTGGTGGCACCACTTCTGGGTGCCTATCTAGGTGGCATCATCTACCTGGTCTTCATTGGCTCCACCATCCCACGGGAGCCCCTGAAATTGGAGGATTCTGTGGCGTATGAAGACCACGGGATAACCGTATTGCCCAAGATGGGATCTCATGAACCCACGATCTCTCCCCTCACCCCCGTCTCTGTGAGCCCTGCCAACAGATCTTCAGTCCACCCTGCCCCACCCTTACATGAATCCATGGCCCTAGAGCACTTCTAA |
| ORF Protein Sequence | MVQASGHRRSTRGSKMVSWSVIAKIQEILQRKMVREFLAEFMSTYVMMVFGLGSVAHMVLNKKYGSYLGVNLGFGFGVTMGVHVAGRISGAHMNAAVTFANCALGRVPWRKFPVYVLGQFLGSFLAAATIYSLFYTAILHFSGGQLMVTGPVATAGIFATYLPDHMTLWRGFLNEAWLTGMLQLCLFAITDQENNPALPGTEALVIGILVVIIGVSLGMNTGYAINPSRDLPPRIFTFIAGWGKQVFSNGENWWWVPVVAPLLGAYLGGIIYLVFIGSTIPREPLKLEDSVAYEDHGITVLPKMGSHEPTISPLTPVSVSPANRSSVHPAPPLHESMALEHF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T94438-Ab | Anti-AQP7/ AQP7L/ AQPap monoclonal antibody |
| Target Antigen | GM-Tg-g-T94438-Ag | AQP7 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003560 | Human AQP7 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003560 | Human AQP7 Lentivirus particle |
Target information
| Target ID | GM-T94438 |
| Target Name | AQP7 |
| Gene ID | 364, 11832, 702836, 29171, 101101423, 474742, 615498, 100068324 |
| Gene Symbol and Synonyms | AQP7,AQP7L,AQPap,GLYCQTL |
| Uniprot Accession | O14520 |
| Uniprot Entry Name | AQP7_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000165269 |
| Target Classification | Not Available |
This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


