Human PRSS8/CAP1/PROSTASIN ORF/cDNA clone-Lentivirus particle (NM_002773)
Cat. No.: vGMLP003561
Pre-made Human PRSS8/CAP1/PROSTASIN Lentiviral expression plasmid for PRSS8 lentivirus packaging, PRSS8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CAP1/PRSS8 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP003561 | Human PRSS8 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP003561 |
| Gene Name | PRSS8 |
| Accession Number | NM_002773 |
| Gene ID | 5652 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1032 bp |
| Gene Alias | CAP1,PROSTASIN |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCCAGAAGGGGGTCCTGGGGCCTGGGCAGCTGGGGGCTGTGGCCATTCTGCTCTATCTTGGATTACTCCGGTCGGGGACAGGAGCGGAAGGGGCAGAAGCTCCCTGCGGTGTGGCCCCCCAAGCACGCATCACAGGTGGCAGCAGTGCAGTCGCCGGTCAGTGGCCCTGGCAGGTCAGCATCACCTATGAAGGCGTCCATGTGTGTGGTGGCTCTCTCGTGTCTGAGCAGTGGGTGCTGTCAGCTGCTCACTGCTTCCCCAGCGAGCACCACAAGGAAGCCTATGAGGTCAAGCTGGGGGCCCACCAGCTAGACTCCTACTCCGAGGACGCCAAGGTCAGCACCCTGAAGGACATCATCCCCCACCCCAGCTACCTCCAGGAGGGCTCCCAGGGCGACATTGCACTCCTCCAACTCAGCAGACCCATCACCTTCTCCCGCTACATCCGGCCCATCTGCCTCCCTGCAGCCAACGCCTCCTTCCCCAACGGCCTCCACTGCACTGTCACTGGCTGGGGTCATGTGGCCCCCTCAGTGAGCCTCCTGACGCCCAAGCCACTGCAGCAACTCGAGGTGCCTCTGATCAGTCGTGAGACGTGTAACTGCCTGTACAACATCGACGCCAAGCCTGAGGAGCCGCACTTTGTCCAAGAGGACATGGTGTGTGCTGGCTATGTGGAGGGGGGCAAGGACGCCTGCCAGGGTGACTCTGGGGGCCCACTCTCCTGCCCTGTGGAGGGTCTCTGGTACCTGACGGGCATTGTGAGCTGGGGAGATGCCTGTGGGGCCCGCAACAGGCCTGGTGTGTACACTCTGGCCTCCAGCTATGCCTCCTGGATCCAAAGCAAGGTGACAGAACTCCAGCCTCGTGTGGTGCCCCAAACCCAGGAGTCCCAGCCCGACAGCAACCTCTGTGGCAGCCACCTGGCCTTCAGCTCTGCCCCAGCCCAGGGCTTGCTGAGGCCCATCCTTTTCCTGCCTCTGGGCCTGGCTCTGGGCCTCCTCTCCCCATGGCTCAGCGAGCACTGA |
| ORF Protein Sequence | MAQKGVLGPGQLGAVAILLYLGLLRSGTGAEGAEAPCGVAPQARITGGSSAVAGQWPWQVSITYEGVHVCGGSLVSEQWVLSAAHCFPSEHHKEAYEVKLGAHQLDSYSEDAKVSTLKDIIPHPSYLQEGSQGDIALLQLSRPITFSRYIRPICLPAANASFPNGLHCTVTGWGHVAPSVSLLTPKPLQQLEVPLISRETCNCLYNIDAKPEEPHFVQEDMVCAGYVEGGKDACQGDSGGPLSCPVEGLWYLTGIVSWGDACGARNRPGVYTLASSYASWIQSKVTELQPRVVPQTQESQPDSNLCGSHLAFSSAPAQGLLRPILFLPLGLALGLLSPWLSEH |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T67339-Ab | Anti-PRSS8/ CAP1/ PROSTASIN monoclonal antibody |
| Target Antigen | GM-Tg-g-T67339-Ag | CAP1/PRSS8 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP003561 | Human PRSS8 Lentivirus plasmid |
| ORF Viral Vector | vGMLP003561 | Human PRSS8 Lentivirus particle |
Target information
| Target ID | GM-T67339 |
| Target Name | CAP1 |
| Gene ID | 5652, 76560, 713176, 192107, 101082616, 102157328, 102148278 |
| Gene Symbol and Synonyms | 2410039E18Rik,CAP1,fr,mCAP1,PROSTASIN,PRSS8 |
| Uniprot Accession | Q16651 |
| Uniprot Entry Name | PRSS8_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000052344 |
| Target Classification | Not Available |
This gene encodes a member of the peptidase S1 or chymotrypsin family of serine proteases. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate via a disulfide bond to form the heterodimeric enzyme. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. This protease exhibits trypsin-like substrate specificity, cleaving protein substrates at the carboxyl terminus of lysine or arginine residues. The encoded protease partially mediates proteolytic activation of the epithelial sodium channel, a regulator of sodium balance, and may also play a role in epithelial barrier formation. [provided by RefSeq, Feb 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


