Human PRSS8/CAP1/PROSTASIN ORF/cDNA clone-Lentivirus particle (NM_002773)

Cat. No.: vGMLP003561

Pre-made Human PRSS8/CAP1/PROSTASIN Lentiviral expression plasmid for PRSS8 lentivirus packaging, PRSS8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CAP1/PRSS8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003561 Human PRSS8 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003561
Gene Name PRSS8
Accession Number NM_002773
Gene ID 5652
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1032 bp
Gene Alias CAP1,PROSTASIN
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCAGAAGGGGGTCCTGGGGCCTGGGCAGCTGGGGGCTGTGGCCATTCTGCTCTATCTTGGATTACTCCGGTCGGGGACAGGAGCGGAAGGGGCAGAAGCTCCCTGCGGTGTGGCCCCCCAAGCACGCATCACAGGTGGCAGCAGTGCAGTCGCCGGTCAGTGGCCCTGGCAGGTCAGCATCACCTATGAAGGCGTCCATGTGTGTGGTGGCTCTCTCGTGTCTGAGCAGTGGGTGCTGTCAGCTGCTCACTGCTTCCCCAGCGAGCACCACAAGGAAGCCTATGAGGTCAAGCTGGGGGCCCACCAGCTAGACTCCTACTCCGAGGACGCCAAGGTCAGCACCCTGAAGGACATCATCCCCCACCCCAGCTACCTCCAGGAGGGCTCCCAGGGCGACATTGCACTCCTCCAACTCAGCAGACCCATCACCTTCTCCCGCTACATCCGGCCCATCTGCCTCCCTGCAGCCAACGCCTCCTTCCCCAACGGCCTCCACTGCACTGTCACTGGCTGGGGTCATGTGGCCCCCTCAGTGAGCCTCCTGACGCCCAAGCCACTGCAGCAACTCGAGGTGCCTCTGATCAGTCGTGAGACGTGTAACTGCCTGTACAACATCGACGCCAAGCCTGAGGAGCCGCACTTTGTCCAAGAGGACATGGTGTGTGCTGGCTATGTGGAGGGGGGCAAGGACGCCTGCCAGGGTGACTCTGGGGGCCCACTCTCCTGCCCTGTGGAGGGTCTCTGGTACCTGACGGGCATTGTGAGCTGGGGAGATGCCTGTGGGGCCCGCAACAGGCCTGGTGTGTACACTCTGGCCTCCAGCTATGCCTCCTGGATCCAAAGCAAGGTGACAGAACTCCAGCCTCGTGTGGTGCCCCAAACCCAGGAGTCCCAGCCCGACAGCAACCTCTGTGGCAGCCACCTGGCCTTCAGCTCTGCCCCAGCCCAGGGCTTGCTGAGGCCCATCCTTTTCCTGCCTCTGGGCCTGGCTCTGGGCCTCCTCTCCCCATGGCTCAGCGAGCACTGA
ORF Protein Sequence MAQKGVLGPGQLGAVAILLYLGLLRSGTGAEGAEAPCGVAPQARITGGSSAVAGQWPWQVSITYEGVHVCGGSLVSEQWVLSAAHCFPSEHHKEAYEVKLGAHQLDSYSEDAKVSTLKDIIPHPSYLQEGSQGDIALLQLSRPITFSRYIRPICLPAANASFPNGLHCTVTGWGHVAPSVSLLTPKPLQQLEVPLISRETCNCLYNIDAKPEEPHFVQEDMVCAGYVEGGKDACQGDSGGPLSCPVEGLWYLTGIVSWGDACGARNRPGVYTLASSYASWIQSKVTELQPRVVPQTQESQPDSNLCGSHLAFSSAPAQGLLRPILFLPLGLALGLLSPWLSEH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T67339-Ab Anti-PRSS8/ CAP1/ PROSTASIN monoclonal antibody
    Target Antigen GM-Tg-g-T67339-Ag CAP1/PRSS8 VLP (virus-like particle)
    ORF Viral Vector pGMLP003561 Human PRSS8 Lentivirus plasmid
    ORF Viral Vector vGMLP003561 Human PRSS8 Lentivirus particle


    Target information

    Target ID GM-T67339
    Target Name CAP1
    Gene ID 5652, 76560, 713176, 192107, 101082616, 102157328, 102148278
    Gene Symbol and Synonyms 2410039E18Rik,CAP1,fr,mCAP1,PROSTASIN,PRSS8
    Uniprot Accession Q16651
    Uniprot Entry Name PRSS8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000052344
    Target Classification Not Available

    This gene encodes a member of the peptidase S1 or chymotrypsin family of serine proteases. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate via a disulfide bond to form the heterodimeric enzyme. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. This protease exhibits trypsin-like substrate specificity, cleaving protein substrates at the carboxyl terminus of lysine or arginine residues. The encoded protease partially mediates proteolytic activation of the epithelial sodium channel, a regulator of sodium balance, and may also play a role in epithelial barrier formation. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.