Human FST/FS ORF/cDNA clone-Lentivirus particle (NM_013409)

Pre-made Human FST/FS Lentiviral expression plasmid for FST lentivirus packaging, FST lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FST/FS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003562 Human FST Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003562
Gene Name FST
Accession Number NM_013409
Gene ID 10468
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1035 bp
Gene Alias FS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCCGCGCGAGGCACCAGCCGGGTGGGCTTTGCCTCCTGCTGCTGCTGCTCTGCCAGTTCATGGAGGACCGCAGTGCCCAGGCTGGGAACTGCTGGCTCCGTCAAGCGAAGAACGGCCGCTGCCAGGTCCTGTACAAGACCGAACTGAGCAAGGAGGAGTGCTGCAGCACCGGCCGGCTGAGCACCTCGTGGACCGAGGAGGACGTGAATGACAACACACTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCCTGTAAAGAAACGTGTGAGAACGTGGACTGTGGACCTGGGAAAAAATGCCGAATGAACAAGAAGAACAAACCCCGCTGCGTCTGCGCCCCGGATTGTTCCAACATCACCTGGAAGGGTCCAGTCTGCGGGCTGGATGGGAAAACCTACCGCAATGAATGTGCACTCCTAAAGGCAAGATGTAAAGAGCAGCCAGAACTGGAAGTCCAGTACCAAGGCAGATGTAAAAAGACTTGTCGGGATGTTTTCTGTCCAGGCAGCTCCACATGTGTGGTGGACCAGACCAATAATGCCTACTGTGTGACCTGTAATCGGATTTGCCCAGAGCCTGCTTCCTCTGAGCAATATCTCTGTGGGAATGATGGAGTCACCTACTCCAGTGCCTGCCACCTGAGAAAGGCTACCTGCCTGCTGGGCAGATCTATTGGATTAGCCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGAAGATATCCAGTGCACTGGTGGGAAAAAATGTTTATGGGATTTCAAGGTTGGGAGAGGCCGGTGTTCCCTCTGTGATGAGCTGTGCCCTGACAGTAAGTCGGATGAGCCTGTCTGTGCCAGTGACAATGCCACTTATGCCAGCGAGTGTGCCATGAAGGAAGCTGCCTGCTCCTCAGGTGTGCTACTGGAAGTAAAGCACTCCGGATCTTGCAACTCCATTTCGGAAGACACCGAGGAAGAGGAGGAAGATGAAGACCAGGACTACAGCTTTCCTATATCTTCTATTCTAGAGTGGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T43901-Ab Anti-FST/ FS functional antibody
    Target Antigen GM-Tg-g-T43901-Ag FST protein
    Cytokine cks-Tg-g-GM-T43901 follistatin (FST) protein & antibody
    ORF Viral Vector pGMLP003562 Human FST Lentivirus plasmid
    ORF Viral Vector vGMLP003562 Human FST Lentivirus particle


    Target information

    Target ID GM-T43901
    Target Name FST
    Gene ID 10468, 14313, 707420, 24373, 101089985, 479336, 327681, 100033825
    Gene Symbol and Synonyms FOL1,FS,FST,Fst-288,RATFOL1
    Uniprot Accession P19883
    Uniprot Entry Name FST_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease ovarian cancer
    Gene Ensembl ENSG00000134363
    Target Classification Not Available

    Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release.  The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA.  In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.