Human FST/FS ORF/cDNA clone-Lentivirus particle (NM_013409)
Pre-made Human FST/FS Lentiviral expression plasmid for FST lentivirus packaging, FST lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FST/FS products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003562 | Human FST Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003562 |
Gene Name | FST |
Accession Number | NM_013409 |
Gene ID | 10468 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1035 bp |
Gene Alias | FS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTCCGCGCGAGGCACCAGCCGGGTGGGCTTTGCCTCCTGCTGCTGCTGCTCTGCCAGTTCATGGAGGACCGCAGTGCCCAGGCTGGGAACTGCTGGCTCCGTCAAGCGAAGAACGGCCGCTGCCAGGTCCTGTACAAGACCGAACTGAGCAAGGAGGAGTGCTGCAGCACCGGCCGGCTGAGCACCTCGTGGACCGAGGAGGACGTGAATGACAACACACTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCCTGTAAAGAAACGTGTGAGAACGTGGACTGTGGACCTGGGAAAAAATGCCGAATGAACAAGAAGAACAAACCCCGCTGCGTCTGCGCCCCGGATTGTTCCAACATCACCTGGAAGGGTCCAGTCTGCGGGCTGGATGGGAAAACCTACCGCAATGAATGTGCACTCCTAAAGGCAAGATGTAAAGAGCAGCCAGAACTGGAAGTCCAGTACCAAGGCAGATGTAAAAAGACTTGTCGGGATGTTTTCTGTCCAGGCAGCTCCACATGTGTGGTGGACCAGACCAATAATGCCTACTGTGTGACCTGTAATCGGATTTGCCCAGAGCCTGCTTCCTCTGAGCAATATCTCTGTGGGAATGATGGAGTCACCTACTCCAGTGCCTGCCACCTGAGAAAGGCTACCTGCCTGCTGGGCAGATCTATTGGATTAGCCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGAAGATATCCAGTGCACTGGTGGGAAAAAATGTTTATGGGATTTCAAGGTTGGGAGAGGCCGGTGTTCCCTCTGTGATGAGCTGTGCCCTGACAGTAAGTCGGATGAGCCTGTCTGTGCCAGTGACAATGCCACTTATGCCAGCGAGTGTGCCATGAAGGAAGCTGCCTGCTCCTCAGGTGTGCTACTGGAAGTAAAGCACTCCGGATCTTGCAACTCCATTTCGGAAGACACCGAGGAAGAGGAGGAAGATGAAGACCAGGACTACAGCTTTCCTATATCTTCTATTCTAGAGTGGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T43901-Ab | Anti-FST/ FS functional antibody |
Target Antigen | GM-Tg-g-T43901-Ag | FST protein |
Cytokine | cks-Tg-g-GM-T43901 | follistatin (FST) protein & antibody |
ORF Viral Vector | pGMLP003562 | Human FST Lentivirus plasmid |
ORF Viral Vector | vGMLP003562 | Human FST Lentivirus particle |
Target information
Target ID | GM-T43901 |
Target Name | FST |
Gene ID | 10468, 14313, 707420, 24373, 101089985, 479336, 327681, 100033825 |
Gene Symbol and Synonyms | FOL1,FS,FST,Fst-288,RATFOL1 |
Uniprot Accession | P19883 |
Uniprot Entry Name | FST_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | ovarian cancer |
Gene Ensembl | ENSG00000134363 |
Target Classification | Not Available |
Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.