Human NODAL/HTX5 ORF/cDNA clone-Lentivirus particle (NM_018055)

Cat. No.: vGMLP003569

Pre-made Human NODAL/HTX5 Lentiviral expression plasmid for NODAL lentivirus packaging, NODAL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to NODAL/HTX5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003569 Human NODAL Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003569
Gene Name NODAL
Accession Number NM_018055
Gene ID 4838
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1044 bp
Gene Alias HTX5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCACGCCCACTGCCTGCCCTTCCTTCTGCACGCCTGGTGGGCCCTACTCCAGGCGGGTGCTGCGACGGTGGCCACTGCGCTCCTGCGTACGCGGGGGCAGCCCTCGTCGCCATCCCCTCTGGCGTACATGCTGAGCCTCTACCGCGACCCGCTGCCGAGGGCAGACATCATCCGCAGCCTACAGGCAGAAGATGTGGCAGTGGATGGGCAGAACTGGACGTTTGCTTTTGACTTCTCCTTCCTGAGCCAACAAGAGGATCTGGCATGGGCTGAGCTCCGGCTGCAGCTGTCCAGCCCTGTGGACCTCCCCACTGAGGGCTCACTTGCCATTGAGATTTTCCACCAGCCAAAGCCCGACACAGAGCAGGCTTCAGACAGCTGCTTAGAGCGGTTTCAGATGGACCTATTCACTGTCACTTTGTCCCAGGTCACCTTTTCCTTGGGCAGCATGGTTTTGGAGGTGACCAGGCCTCTCTCCAAGTGGCTGAAGCACCCTGGGGCCCTGGAGAAGCAGATGTCCAGGGTAGCTGGAGAGTGCTGGCCGCGGCCCCCCACACCGCCTGCCACCAATGTGCTCCTTATGCTCTACTCCAACCTCTCGCAGGAGCAGAGGCAGCTGGGTGGGTCCACCTTGCTGTGGGAAGCCGAGAGCTCCTGGCGGGCCCAGGAGGGACAGCTGTCCTGGGAGTGGGGCAAGAGGCACCGTCGACATCACTTGCCAGACAGAAGTCAACTGTGTCGGAAGGTCAAGTTCCAGGTGGACTTCAACCTGATCGGATGGGGCTCCTGGATCATCTACCCCAAGCAGTACAACGCCTATCGCTGTGAGGGCGAGTGTCCTAATCCTGTTGGGGAGGAGTTTCATCCGACCAACCATGCATACATCCAGAGTCTGCTGAAACGTTACCAGCCCCACCGAGTCCCTTCCACTTGTTGTGCCCCAGTGAAGACCAAGCCGCTGAGCATGCTGTATGTGGATAATGGCAGAGTGCTCCTAGATCACCATAAAGACATGATCGTGGAAGAATGTGGGTGCCTCTGA
ORF Protein Sequence MHAHCLPFLLHAWWALLQAGAATVATALLRTRGQPSSPSPLAYMLSLYRDPLPRADIIRSLQAEDVAVDGQNWTFAFDFSFLSQQEDLAWAELRLQLSSPVDLPTEGSLAIEIFHQPKPDTEQASDSCLERFQMDLFTVTLSQVTFSLGSMVLEVTRPLSKWLKHPGALEKQMSRVAGECWPRPPTPPATNVLLMLYSNLSQEQRQLGGSTLLWEAESSWRAQEGQLSWEWGKRHRRHHLPDRSQLCRKVKFQVDFNLIGWGSWIIYPKQYNAYRCEGECPNPVGEEFHPTNHAYIQSLLKRYQPHRVPSTCCAPVKTKPLSMLYVDNGRVLLDHHKDMIVEECGCL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T87448-Ab Anti-NODAL/ HTX5 functional antibody
    Target Antigen GM-Tg-g-T87448-Ag NODAL protein
    ORF Viral Vector pGMLP003569 Human NODAL Lentivirus plasmid
    ORF Viral Vector vGMLP003569 Human NODAL Lentivirus particle


    Target information

    Target ID GM-T87448
    Target Name NODAL
    Gene ID 4838, 18119, 710424, 294503, 101096673, 489028, 530748, 100072735
    Gene Symbol and Synonyms HTX5,NODAL,Tg.413d
    Uniprot Accession Q96S42
    Uniprot Entry Name NODAL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000156574
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which regulates early embryonic development. This protein is required for maintenance of human embryonic stem cell pluripotency and may play a role in human placental development. Mutations in this gene are associated with heterotaxy, a condition characterized by random orientation of visceral organs with respect to the left-right axis. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.