Human SLC9A3R1/EBP50/NHERF ORF/cDNA clone-Lentivirus particle (NM_004252)

Cat. No.: vGMLP003586

Pre-made Human SLC9A3R1/EBP50/NHERF Lentiviral expression plasmid for SLC9A3R1 lentivirus packaging, SLC9A3R1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SLC9A3R1/EBP50 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003586 Human SLC9A3R1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003586
Gene Name SLC9A3R1
Accession Number NM_004252
Gene ID 9368
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1077 bp
Gene Alias EBP50,NHERF,NHERF-1,NHERF1,NPHLOP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCGCGGACGCAGCGGCCGGGGCGCCCCTGCCCCGGCTCTGCTGCCTGGAGAAGGGTCCGAACGGCTACGGCTTCCACCTGCACGGGGAGAAGGGCAAGTTGGGCCAGTACATCCGGCTGGTGGAGCCCGGCTCGCCGGCCGAGAAGGCGGGGCTGCTGGCGGGGGACCGGCTGGTGGAGGTGAACGGCGAAAACGTGGAGAAGGAGACCCACCAGCAGGTGGTGAGCCGCATCCGCGCCGCACTCAACGCCGTGCGCCTGCTGGTGGTCGACCCCGAGACGGACGAGCAGCTGCAGAAGCTCGGCGTCCAGGTCCGAGAGGAGCTGCTGCGCGCCCAGGAAGCGCCGGGGCAGGCCGAGCCGCCGGCCGCCGCCGAGGTGCAGGGGGCTGGCAACGAAAATGAGCCTCGCGAGGCCGACAAGAGCCACCCGGAGCAGCGCGAGCTTCGGCCTCGGCTCTGTACCATGAAGAAGGGCCCCAGTGGCTATGGCTTCAACCTGCACAGCGACAAGTCCAAGCCAGGCCAGTTCATCCGGTCAGTGGACCCAGACTCCCCGGCTGAGGCTTCAGGGCTCCGGGCCCAGGATCGCATTGTGGAGGTGAACGGGGTCTGCATGGAGGGGAAGCAGCATGGGGACGTGGTGTCCGCCATCAGGGCTGGCGGGGACGAGACCAAGCTGCTGGTGGTGGACAGGGAAACTGACGAGTTCTTCAAGAAATGCAGAGTGATCCCATCTCAGGAGCACCTGAATGGTCCCCTGCCTGTGCCCTTCACCAATGGGGAGATACAGAAGGAGAACAGTCGTGAAGCCCTGGCAGAGGCAGCCTTGGAGAGCCCCAGGCCAGCCCTGGTGAGATCCGCCTCCAGTGACACCAGCGAGGAGCTGAATTCCCAAGACAGCCCCCCAAAACAGGACTCCACAGCGCCCTCGTCTACCTCCTCCTCCGACCCCATCCTAGACTTCAACATCTCCCTGGCCATGGCCAAAGAGAGGGCCCACCAGAAACGCAGCAGCAAACGGGCCCCGCAGATGGACTGGAGCAAGAAAAACGAACTCTTCAGCAACCTCTGA
ORF Protein Sequence MSADAAAGAPLPRLCCLEKGPNGYGFHLHGEKGKLGQYIRLVEPGSPAEKAGLLAGDRLVEVNGENVEKETHQQVVSRIRAALNAVRLLVVDPETDEQLQKLGVQVREELLRAQEAPGQAEPPAAAEVQGAGNENEPREADKSHPEQRELRPRLCTMKKGPSGYGFNLHSDKSKPGQFIRSVDPDSPAEASGLRAQDRIVEVNGVCMEGKQHGDVVSAIRAGGDETKLLVVDRETDEFFKKCRVIPSQEHLNGPLPVPFTNGEIQKENSREALAEAALESPRPALVRSASSDTSEELNSQDSPPKQDSTAPSSTSSSDPILDFNISLAMAKERAHQKRSSKRAPQMDWSKKNELFSNL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1747-Ab Anti-SLC9A3R1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1747-Ag SLC9A3R1 protein
    ORF Viral Vector pGMLP003586 Human SLC9A3R1 Lentivirus plasmid
    ORF Viral Vector vGMLP003586 Human SLC9A3R1 Lentivirus particle


    Target information

    Target ID GM-IP1747
    Target Name SLC9A3R1
    Gene ID 9368, 26941, 703933, 59114, 101091236, 483299, 505242, 100052527
    Gene Symbol and Synonyms EBP-50,EBP50,NHE-RF,NHERF,NHERF-1,NHERF1,NPHLOP2,SLC9A3R1
    Uniprot Accession O14745
    Uniprot Entry Name NHRF1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000109062
    Target Classification Not Available

    This gene encodes a sodium/hydrogen exchanger regulatory cofactor. The protein interacts with and regulates various proteins including the cystic fibrosis transmembrane conductance regulator and G-protein coupled receptors such as the beta2-adrenergic receptor and the parathyroid hormone 1 receptor. The protein also interacts with proteins that function as linkers between integral membrane and cytoskeletal proteins. The protein localizes to actin-rich structures including membrane ruffles, microvilli, and filopodia. Mutations in this gene result in hypophosphatemic nephrolithiasis/osteoporosis type 2, and loss of heterozygosity of this gene is implicated in breast cancer.[provided by RefSeq, Sep 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.