Human TNFRSF9/4-1BB/ CD137 ORF/cDNA clone-Lentivirus particle (NM_001561)

Pre-made Human TNFRSF9/4-1BB/ CD137 Lentiviral expression plasmid for TNFRSF9 lentivirus packaging, TNFRSF9 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CD137/TNFRSF9/4-1BB products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003848 Human TNFRSF9 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003848
Gene Name TNFRSF9
Accession Number NM_001561
Gene ID 3604
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 768 bp
Gene Alias 4-1BB, CD137, CDw137, ILA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGAAACAGCTGTTACAACATAGTAGCCACTCTGTTGCTGGTCCTCAACTTTGAGAGGACAAGATCATTGCAGGATCCTTGTAGTAACTGCCCAGCTGGTACATTCTGTGATAATAACAGGAATCAGATTTGCAGTCCCTGTCCTCCAAATAGTTTCTCCAGCGCAGGTGGACAAAGGACCTGTGACATATGCAGGCAGTGTAAAGGTGTTTTCAGGACCAGGAAGGAGTGTTCCTCCACCAGCAATGCAGAGTGTGACTGCACTCCAGGGTTTCACTGCCTGGGGGCAGGATGCAGCATGTGTGAACAGGATTGTAAACAAGGTCAAGAACTGACAAAAAAAGGTTGTAAAGACTGTTGCTTTGGGACATTTAACGATCAGAAACGTGGCATCTGTCGACCCTGGACAAACTGTTCTTTGGATGGAAAGTCTGTGCTTGTGAATGGGACGAAGGAGAGGGACGTGGTCTGTGGACCATCTCCAGCCGACCTCTCTCCGGGAGCATCCTCTGTGACCCCGCCTGCCCCTGCGAGAGAGCCAGGACACTCTCCGCAGATCATCTCCTTCTTTCTTGCGCTGACGTCGACTGCGTTGCTCTTCCTGCTGTTCTTCCTCACGCTCCGTTTCTCTGTTGTTAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-780 Pre-Made Cinrebafusp Alfa P Alfaiosimilar, Bispecific, Anti-ERBB2/HER2;TNFRSF9 Antibody: Anti-CD340/MLN 19/NEU/NGL/TKR1/VSCN2;ILA/4-1BB/CDw137 therapeutic antibody
    Biosimilar GMP-Bios-ab-606 Pre-Made Utomilumab biosimilar, Whole mAb, Anti-TNFRSF9/CD137 Antibody: Anti-ILA/4-1BB/CDw137 therapeutic antibody
    Biosimilar GMP-Bios-ab-701 Pre-Made Tecaginlimab biosimilar, Whole mAb, Anti-CD40;TNFRSF9/CD137 Antibody: Anti-p50/Bp50/CDW40/TNFRSF5;ILA/4-1BB/CDw137 therapeutic antibody
    Biosimilar GMP-Bios-INN-836 Pre-Made Ensomafusp Alfa  Alfaiosimilar, Bispecific, Anti-Cd19; Tnfrsf9 Antibody: Anti-B4/CVID3;ILA/4-1BB/CDw137 therapeutic antibody
    Biosimilar GMP-Bios-ab-604 Pre-Made Urelumab biosimilar, Whole mAb, Anti-TNFRSF9/CD137 Antibody: Anti-ILA/4-1BB/CDw137 therapeutic antibody
    Biosimilar GMP-Bios-ab-007 Pre-Made Acasunlimab biosimilar, Bispecific mAb, Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1;ILA/4-1BB/CDw137 Antibod: Anti-CD274/PD-L1;TNFRSF9/CD137 therapeutic antibody
    Target Antibody GM-Tg-g-T93923-Ab Anti-TNR9/ CD137/ TNFRSF9 monoclonal antibody
    Target Antigen GM-Tg-g-T93923-Ag CD137/TNFRSF9 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T93923 tumor necrosis factor receptor superfamily, member 9 (TNFRSF9) protein & antibody
    ORF Viral Vector pGMLP003848 Human TNFRSF9 Lentivirus plasmid
    ORF Viral Vector vGMLP003848 Human TNFRSF9 Lentivirus particle


    Target information

    Target ID GM-T93923
    Target Name CD137
    Gene ID 3604, 21942, 708281, 500590, 101096582, 608274, 520341, 100058657
    Gene Symbol and Synonyms 4-1BB,A930040I11Rik,CD137,CDw137,ILA,IMD109,Ly63,TNFRSF9
    Uniprot Accession Q07011
    Uniprot Entry Name TNR9_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000049249
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.