Human ZD52F10/UNQ729 ORF/cDNA clone-Lentivirus particle (BC011886)
Cat. No.: vGMLP004013
Pre-made Human ZD52F10/UNQ729 Lentiviral expression plasmid for ZD52F10 lentivirus packaging, ZD52F10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
DMKN/ZD52F10/UNQ729 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004013 | Human ZD52F10 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004013 |
Gene Name | ZD52F10 |
Accession Number | BC011886 |
Gene ID | 93099 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 414 bp |
Gene Alias | UNQ729 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTTTAACTTTGACACTTTCTGGAAGAATTTTAAATCCAAGCTGGGTTTCATCAACTGGGATGCCATAAACAAGAACCAGGTCCCGCCCCCCAGCACCCGAGCCCTCCTCTACTTCAGCCGACTCTGGGAGGATTTCAAACAGAACACTCCTTTCCTCAACTGGAAAGCAATTATTGAGGGTGCGGACGCGTCATCACTGCAGAAACGTGCAGGCAGAGCCGATCAGCCGGGTGCAGGATGGCAGGAGGTGGCAGCTGTAACTTCCAAGAACTACAATTACAACCAGCATGCGTATCCCACTGCCTATGGTGGGAAGTACTCAGTCAAGACCCCTGCAAAGGGGGGAGTCTCACCTTCTTCCTCGGCTTCCCGGGTGCAACCTGGCCTGCTGCAGTGGGTGAAGTTTTGGTAG |
ORF Protein Sequence | MFNFDTFWKNFKSKLGFINWDAINKNQVPPPSTRALLYFSRLWEDFKQNTPFLNWKAIIEGADASSLQKRAGRADQPGAGWQEVAAVTSKNYNYNQHAYPTAYGGKYSVKTPAKGGVSPSSSASRVQPGLLQWVKFW |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0890-Ab | Anti-DMKN/ UNQ729/ ZD52F10 functional antibody |
Target Antigen | GM-Tg-g-SE0890-Ag | DMKN protein |
ORF Viral Vector | pGMLP004013 | Human ZD52F10 Lentivirus plasmid |
ORF Viral Vector | vGMLP004013 | Human ZD52F10 Lentivirus particle |
Target information
Target ID | GM-SE0890 |
Target Name | DMKN |
Gene ID | 93099, 73712, 718709, 361548, 101100017, 476484, 618159, 102150590 |
Gene Symbol and Synonyms | 1110014F24Rik,C130074A08,cI-36,DMKN,RGD1561521,SK30,SK89,UNQ729,ZD52F10 |
Uniprot Accession | Q6E0U4 |
Uniprot Entry Name | DMKN_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000161249 |
Target Classification | Not Available |
This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.