Human ZD52F10/UNQ729 ORF/cDNA clone-Lentivirus particle (BC011886)

Cat. No.: vGMLP004013

Pre-made Human ZD52F10/UNQ729 Lentiviral expression plasmid for ZD52F10 lentivirus packaging, ZD52F10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to DMKN/ZD52F10/UNQ729 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004013 Human ZD52F10 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004013
Gene Name ZD52F10
Accession Number BC011886
Gene ID 93099
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 414 bp
Gene Alias UNQ729
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTTAACTTTGACACTTTCTGGAAGAATTTTAAATCCAAGCTGGGTTTCATCAACTGGGATGCCATAAACAAGAACCAGGTCCCGCCCCCCAGCACCCGAGCCCTCCTCTACTTCAGCCGACTCTGGGAGGATTTCAAACAGAACACTCCTTTCCTCAACTGGAAAGCAATTATTGAGGGTGCGGACGCGTCATCACTGCAGAAACGTGCAGGCAGAGCCGATCAGCCGGGTGCAGGATGGCAGGAGGTGGCAGCTGTAACTTCCAAGAACTACAATTACAACCAGCATGCGTATCCCACTGCCTATGGTGGGAAGTACTCAGTCAAGACCCCTGCAAAGGGGGGAGTCTCACCTTCTTCCTCGGCTTCCCGGGTGCAACCTGGCCTGCTGCAGTGGGTGAAGTTTTGGTAG
ORF Protein Sequence MFNFDTFWKNFKSKLGFINWDAINKNQVPPPSTRALLYFSRLWEDFKQNTPFLNWKAIIEGADASSLQKRAGRADQPGAGWQEVAAVTSKNYNYNQHAYPTAYGGKYSVKTPAKGGVSPSSSASRVQPGLLQWVKFW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0890-Ab Anti-DMKN/ UNQ729/ ZD52F10 functional antibody
    Target Antigen GM-Tg-g-SE0890-Ag DMKN protein
    ORF Viral Vector pGMLP004013 Human ZD52F10 Lentivirus plasmid
    ORF Viral Vector vGMLP004013 Human ZD52F10 Lentivirus particle


    Target information

    Target ID GM-SE0890
    Target Name DMKN
    Gene ID 93099, 73712, 718709, 361548, 101100017, 476484, 618159, 102150590
    Gene Symbol and Synonyms 1110014F24Rik,C130074A08,cI-36,DMKN,RGD1561521,SK30,SK89,UNQ729,ZD52F10
    Uniprot Accession Q6E0U4
    Uniprot Entry Name DMKN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000161249
    Target Classification Not Available

    This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.