Human NQO2/DHQV/DIA6 ORF/cDNA clone-Lentivirus particle (BC006096)

Cat. No.: vGMLP004023

Pre-made Human NQO2/DHQV/DIA6 Lentiviral expression plasmid for NQO2 lentivirus packaging, NQO2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to NQO2/DHQV products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004023 Human NQO2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004023
Gene Name NQO2
Accession Number BC006096
Gene ID 4835
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 696 bp
Gene Alias DHQV,DIA6,QR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGGTAAGAAAGTACTCATTGTCTATGCACACCAGGAACCCAAGTCTTTCAACGGATCCTTGAAGAATGTGGCTGTAGATGAACTGAGCAGGCAGGGCTGCACCGTCACAGTGTCTGATTTGTATGCCATGAACTTTGAGCCGAGGGCCACAGACAAAGATATCACTGGTACTCTTTCTAATCCTGAGGTTTTCAATTATGGAGTGGAAACCCACGAAGCCTACAAGCAAAGGTCTCTGGCTAGCGACATCACTGATGAGCAGAAAAAGGTTCGGGAGGCTGACCTAGTGATATTTCAGTTCCCGCTGTACTGGTTCAGCGTGCCGGCCATCCTGAAGGGCTGGATGGATAGGGTGCTGTGCCAGGGCTTTGCCTTTGACATCCCAGGATTCTACGATTCCGGTTTGCTCCAGGGTAAACTAGCGCTCCTTTCCGTAACCACGGGAGGCACGGCCGAGATGTACACGAAGACAGGAGTCAATGGAGATTCTCGATACTTCCTGTGGCCACTCCAGCATGGCACATTACACTTCTGTGGATTTAAAGTCCTTGCCCCTCAGATCAGCTTTGCTCCTGAAATTGCATCCGAAGAAGAAAGAAAGGGGATGGTGGCTGCGTGGTCCCAGAGGCTGCAGACCATCTGGAAGGAAGAGCCCATCCCCTGCACAGCCCACTGGCACTTCGGGCAATAA
ORF Protein Sequence MAGKKVLIVYAHQEPKSFNGSLKNVAVDELSRQGCTVTVSDLYAMNFEPRATDKDITGTLSNPEVFNYGVETHEAYKQRSLASDITDEQKKVREADLVIFQFPLYWFSVPAILKGWMDRVLCQGFAFDIPGFYDSGLLQGKLALLSVTTGGTAEMYTKTGVNGDSRYFLWPLQHGTLHFCGFKVLAPQISFAPEIASEEERKGMVAAWSQRLQTIWKEEPIPCTAHWHFGQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T75498-Ab Anti-NQO2 monoclonal antibody
    Target Antigen GM-Tg-g-T75498-Ag NQO2 protein
    ORF Viral Vector pGMLP003468 Human NQO2 Lentivirus plasmid
    ORF Viral Vector pGMLP004023 Human NQO2 Lentivirus plasmid
    ORF Viral Vector vGMLP003468 Human NQO2 Lentivirus particle
    ORF Viral Vector vGMLP004023 Human NQO2 Lentivirus particle


    Target information

    Target ID GM-T75498
    Target Name NQO2
    Gene ID 4835, 18105, 707675, 291084, 101085630, 606932, 508566, 100057868
    Gene Symbol and Synonyms DHQV,DIA6,NMO2,NMOR2,NQO2,Ox2,QR2
    Uniprot Accession P16083
    Uniprot Entry Name NQO2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000124588
    Target Classification Not Available

    This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.