Human SURF4/ERV29 ORF/cDNA clone-Lentivirus particle (NM_033161)

Cat. No.: vGMLP004238

Pre-made Human SURF4/ERV29 Lentiviral expression plasmid for SURF4 lentivirus packaging, SURF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SURF4/ERV29 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004238 Human SURF4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004238
Gene Name SURF4
Accession Number NM_033161
Gene ID 6836
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 810 bp
Gene Alias ERV29
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCCAGAACGACCTGATGGGCACGGCCGAGGACTTCGCCGACCAGTTCCTCCGTGTCACAAAGCAGTACCTGCCCCACGTGGCGCGCCTCTGTCTGATCAGCACCTTCCTGGAGGACGGCATCCGTATGTGGTTCCAGTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGCGGCTACCTGCTGGCCTCGTCCTTCGTCTTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTGTTGAGCAGGAACTTCGTGCAGTACGCCTGCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCCTACAGCATTTTATGGGACTTGAAGTTTTTGATGAGGAACCTGGCCCTGGGAGGAGGCCTGTTGCTGCTCCTAGCAGAATCCCGTTCTGAAGGGAAGAGCATGTTTGCGGGCGTCCCCACCATGCGTGAGAGCTCCCCCAAACAGTACATGCAGCTCGGAGGCAGGGTCTTGCTGGTTCTGATGTTCATGACCCTCCTTCACTTTGACGCCAGCTTCTTTTCTATTGTCCAGAACATCGTGGGCACAGCTCTGATGATTTTAGTGGCCATTGGTTTTAAAACCAAGCTGGCTGCTTTGACTCTTGTTGTGTGGCTCTTTGCCATCAACGTATATTTCAACGCCTTCTGGACCATTCCAGTCTACAAGCCCATGCATGACTTCCTGAAATACGACTTCTTCCAGACCATGTCGGTGATTGGGGGCTTGCTCCTGGTGGTGGCCCTGGGCCCTGGGGGTGTCTCCATGGATGAGAAGAAGAAGGAGTGGTAA
ORF Protein Sequence MGQNDLMGTAEDFADQFLRVTKQYLPHVARLCLISTFLEDGIRMWFQWSEQRDYIDTTWNCGYLLASSFVFLNLLGQLTGCVLVLSRNFVQYACFGLFGIIALQTIAYSILWDLKFLMRNLALGGGLLLLLAESRSEGKSMFAGVPTMRESSPKQYMQLGGRVLLVLMFMTLLHFDASFFSIVQNIVGTALMILVAIGFKTKLAALTLVVWLFAINVYFNAFWTIPVYKPMHDFLKYDFFQTMSVIGGLLLVVALGPGGVSMDEKKKEW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1732-Ab Anti-SURF4/ ERV29 monoclonal antibody
    Target Antigen GM-Tg-g-MP1732-Ag SURF4 VLP (virus-like particle)
    ORF Viral Vector pGMLP004238 Human SURF4 Lentivirus plasmid
    ORF Viral Vector vGMLP004238 Human SURF4 Lentivirus particle


    Target information

    Target ID GM-MP1732
    Target Name SURF4
    Gene ID 6836, 20932, 100429963, 619346, 101084494, 491269, 526045, 100069310
    Gene Symbol and Synonyms ERV29,Surf-4,SURF4
    Uniprot Accession O15260
    Uniprot Entry Name SURF4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000148248
    Target Classification Not Available

    This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.