Human SURF4/ERV29 ORF/cDNA clone-Lentivirus particle (NM_033161)
Cat. No.: vGMLP004238
Pre-made Human SURF4/ERV29 Lentiviral expression plasmid for SURF4 lentivirus packaging, SURF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
SURF4/ERV29 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004238 | Human SURF4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004238 |
| Gene Name | SURF4 |
| Accession Number | NM_033161 |
| Gene ID | 6836 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 810 bp |
| Gene Alias | ERV29 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGCCAGAACGACCTGATGGGCACGGCCGAGGACTTCGCCGACCAGTTCCTCCGTGTCACAAAGCAGTACCTGCCCCACGTGGCGCGCCTCTGTCTGATCAGCACCTTCCTGGAGGACGGCATCCGTATGTGGTTCCAGTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGCGGCTACCTGCTGGCCTCGTCCTTCGTCTTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTGTTGAGCAGGAACTTCGTGCAGTACGCCTGCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCCTACAGCATTTTATGGGACTTGAAGTTTTTGATGAGGAACCTGGCCCTGGGAGGAGGCCTGTTGCTGCTCCTAGCAGAATCCCGTTCTGAAGGGAAGAGCATGTTTGCGGGCGTCCCCACCATGCGTGAGAGCTCCCCCAAACAGTACATGCAGCTCGGAGGCAGGGTCTTGCTGGTTCTGATGTTCATGACCCTCCTTCACTTTGACGCCAGCTTCTTTTCTATTGTCCAGAACATCGTGGGCACAGCTCTGATGATTTTAGTGGCCATTGGTTTTAAAACCAAGCTGGCTGCTTTGACTCTTGTTGTGTGGCTCTTTGCCATCAACGTATATTTCAACGCCTTCTGGACCATTCCAGTCTACAAGCCCATGCATGACTTCCTGAAATACGACTTCTTCCAGACCATGTCGGTGATTGGGGGCTTGCTCCTGGTGGTGGCCCTGGGCCCTGGGGGTGTCTCCATGGATGAGAAGAAGAAGGAGTGGTAA |
| ORF Protein Sequence | MGQNDLMGTAEDFADQFLRVTKQYLPHVARLCLISTFLEDGIRMWFQWSEQRDYIDTTWNCGYLLASSFVFLNLLGQLTGCVLVLSRNFVQYACFGLFGIIALQTIAYSILWDLKFLMRNLALGGGLLLLLAESRSEGKSMFAGVPTMRESSPKQYMQLGGRVLLVLMFMTLLHFDASFFSIVQNIVGTALMILVAIGFKTKLAALTLVVWLFAINVYFNAFWTIPVYKPMHDFLKYDFFQTMSVIGGLLLVVALGPGGVSMDEKKKEW |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP1732-Ab | Anti-SURF4/ ERV29 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP1732-Ag | SURF4 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004238 | Human SURF4 Lentivirus plasmid |
| ORF Viral Vector | vGMLP004238 | Human SURF4 Lentivirus particle |
Target information
| Target ID | GM-MP1732 |
| Target Name | SURF4 |
| Gene ID | 6836, 20932, 100429963, 619346, 101084494, 491269, 526045, 100069310 |
| Gene Symbol and Synonyms | ERV29,Surf-4,SURF4 |
| Uniprot Accession | O15260 |
| Uniprot Entry Name | SURF4_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000148248 |
| Target Classification | Not Available |
This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


