Human TAFA4/TAFA-4/ TAFA4 ORF/cDNA clone-Lentivirus particle (NM_182522)
Pre-made Human TAFA4/TAFA-4/ TAFA4 Lentiviral expression plasmid for TAFA4 lentivirus packaging, TAFA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FAM19A4/TAFA4/TAFA-4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004273 | Human TAFA4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004273 |
Gene Name | TAFA4 |
Accession Number | NM_182522 |
Gene ID | 151647 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 423 bp |
Gene Alias | TAFA-4, TAFA4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGTCCCCAAGGATGAGAGTCTGTGCTAAGTCAGTGTTGCTGTCGCACTGGCTCTTTCTAGCCTACGTGTTAATGGTGTGCTGTAAGCTGATGTCCGCCTCAAGCCAGCACCTCCGGGGACATGCAGGTCACCACCAAATCAAGCAAGGGACCTGTGAGGTGGTCGCCGTGCACAGGTGCTGCAATAAGAACCGCATAGAAGAGCGGTCACAAACGGTCAAGTGCTCTTGCTTCCCGGGACAGGTGGCGGGCACAACTCGGGCTCAACCTTCTTGTGTTGAAGCTTCCATTGTGATTCAGAAATGGTGGTGTCACATGAATCCGTGTTTGGAAGGAGAGGATTGTAAAGTGCTGCCAGATTACTCAGGTTGGTCCTGTAGCAGTGGCAATAAAGTCAAAACTACGAAGGTAACGCGGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0196-Ab | Anti-TAFA4/ FAM19A4/ TAFA-4 functional antibody |
Target Antigen | GM-Tg-g-SE0196-Ag | FAM19A4 protein |
Cytokine | cks-Tg-g-GM-SE0196 | family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 (FAM19A4) protein & antibody |
ORF Viral Vector | pGMLP004273 | Human TAFA4 Lentivirus plasmid |
ORF Viral Vector | vGMLP004273 | Human TAFA4 Lentivirus particle |
Target information
Target ID | GM-SE0196 |
Target Name | FAM19A4 |
Gene ID | 151647, 320701, 696987, 689043, 101089425, 610997, 616873, 100629222 |
Gene Symbol and Synonyms | C130034I18Rik,FAM19A4,Fam19a4 Tafa-4,TAFA-4,TAFA4 |
Uniprot Accession | Q96LR4 |
Uniprot Entry Name | TAFA4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000163377 |
Target Classification | Not Available |
This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines, that act as regulators of immune and nervous cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Nov 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.