Human TAFA4/TAFA-4/ TAFA4 ORF/cDNA clone-Lentivirus particle (NM_182522)

Pre-made Human TAFA4/TAFA-4/ TAFA4 Lentiviral expression plasmid for TAFA4 lentivirus packaging, TAFA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FAM19A4/TAFA4/TAFA-4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004273 Human TAFA4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004273
Gene Name TAFA4
Accession Number NM_182522
Gene ID 151647
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 423 bp
Gene Alias TAFA-4, TAFA4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGTCCCCAAGGATGAGAGTCTGTGCTAAGTCAGTGTTGCTGTCGCACTGGCTCTTTCTAGCCTACGTGTTAATGGTGTGCTGTAAGCTGATGTCCGCCTCAAGCCAGCACCTCCGGGGACATGCAGGTCACCACCAAATCAAGCAAGGGACCTGTGAGGTGGTCGCCGTGCACAGGTGCTGCAATAAGAACCGCATAGAAGAGCGGTCACAAACGGTCAAGTGCTCTTGCTTCCCGGGACAGGTGGCGGGCACAACTCGGGCTCAACCTTCTTGTGTTGAAGCTTCCATTGTGATTCAGAAATGGTGGTGTCACATGAATCCGTGTTTGGAAGGAGAGGATTGTAAAGTGCTGCCAGATTACTCAGGTTGGTCCTGTAGCAGTGGCAATAAAGTCAAAACTACGAAGGTAACGCGGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0196-Ab Anti-TAFA4/ FAM19A4/ TAFA-4 functional antibody
    Target Antigen GM-Tg-g-SE0196-Ag FAM19A4 protein
    Cytokine cks-Tg-g-GM-SE0196 family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 (FAM19A4) protein & antibody
    ORF Viral Vector pGMLP004273 Human TAFA4 Lentivirus plasmid
    ORF Viral Vector vGMLP004273 Human TAFA4 Lentivirus particle


    Target information

    Target ID GM-SE0196
    Target Name FAM19A4
    Gene ID 151647, 320701, 696987, 689043, 101089425, 610997, 616873, 100629222
    Gene Symbol and Synonyms C130034I18Rik,FAM19A4,Fam19a4 Tafa-4,TAFA-4,TAFA4
    Uniprot Accession Q96LR4
    Uniprot Entry Name TAFA4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000163377
    Target Classification Not Available

    This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines, that act as regulators of immune and nervous cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Nov 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.